View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_212 (Length: 202)
Name: NF0412_high_212
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_212 |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
[»] scaffold0295 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 3e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 78 - 202
Target Start/End: Original strand, 26695124 - 26695248
Alignment:
Q |
78 |
atgaacgcggatggagctcctggtcctgatggcttcgggggacatttctatcaacatttttgggacattgtggcggtcgatgtagtgagttcgttacaag |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26695124 |
atgaacgcggatggagctcctggtcctgatggcttcgggggacatttctatcaatatttttgggacattgtggcggtcgatgtagtgagttcgttacaag |
26695223 |
T |
 |
Q |
178 |
atttcttttacacaggggcgctgat |
202 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
26695224 |
atttcttttacacaggggcgctgat |
26695248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 78 - 202
Target Start/End: Original strand, 26964856 - 26964980
Alignment:
Q |
78 |
atgaacgcggatggagctcctggtcctgatggcttcgggggacatttctatcaacatttttgggacattgtggcggtcgatgtagtgagttcgttacaag |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26964856 |
atgaacgcggatggagctcctggtcctgatggcttcgggggacatttctatcaatatttttgggacattgtggcggtcgatgtagtgagttcgttacaag |
26964955 |
T |
 |
Q |
178 |
atttcttttacacaggggcgctgat |
202 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
26964956 |
atttcttttacacaggggcgctgat |
26964980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 78 - 202
Target Start/End: Complemental strand, 22834263 - 22834139
Alignment:
Q |
78 |
atgaacgcggatggagctcctggtcctgatggcttcgggggacatttctatcaacatttttgggacattgtggcggtcgatgtagtgagttcgttacaag |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
22834263 |
atgaacgcggatggagctcctggtcctgatggcttcgggggccatttctatcaatatttttgggacattgtggcggtcgatgtagtgagttcggtacaag |
22834164 |
T |
 |
Q |
178 |
atttcttttacacaggggcgctgat |
202 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
22834163 |
atttcttttacacaggggcgctgat |
22834139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 78 - 190
Target Start/End: Complemental strand, 32134215 - 32134103
Alignment:
Q |
78 |
atgaacgcggatggagctcctggtcctgatggcttcgggggacatttctatcaacatttttgggacattgtggcggtcgatgtagtgagttcgttacaag |
177 |
Q |
|
|
||||| || ||||| ||||| || | ||||||||| ||||||||||| ||||| ||||||||||||||||| | ||||||||| || ||||| ||||| |
|
|
T |
32134215 |
atgaatgcagatggcgctccgggccatgatggctttgggggacatttttatcagcatttttgggacattgttggggtcgatgttgtcagttcagtacaac |
32134116 |
T |
 |
Q |
178 |
atttcttttacac |
190 |
Q |
|
|
| || |||||||| |
|
|
T |
32134115 |
aatttttttacac |
32134103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0295 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0295
Description:
Target: scaffold0295; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 202
Target Start/End: Complemental strand, 20928 - 20855
Alignment:
Q |
129 |
caacatttttgggacattgtggcggtcgatgtagtgagttcgttacaagatttcttttacacaggggcgctgat |
202 |
Q |
|
|
||||||||||||||||||||| || | ||||| ||||||||| | || || || |||||||| ||||||||||| |
|
|
T |
20928 |
caacatttttgggacattgtgtcgatggatgtggtgagttcggtgcaggaatttttttacacgggggcgctgat |
20855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 184
Target Start/End: Original strand, 42064843 - 42064893
Alignment:
Q |
134 |
tttttgggacattgtggcggtcgatgtagtgagttcgttacaagatttctt |
184 |
Q |
|
|
||||||||||||||||||||| ||||| ||||||||| | ||||| ||||| |
|
|
T |
42064843 |
tttttgggacattgtggcggtggatgttgtgagttcggttcaagaattctt |
42064893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 151
Target Start/End: Complemental strand, 12675242 - 12675190
Alignment:
Q |
99 |
ggtcctgatggcttcgggggacatttctatcaacatttttgggacattgtggc |
151 |
Q |
|
|
||||||||||| || ||||||||||| ||||| || ||||||||||| ||||| |
|
|
T |
12675242 |
ggtcctgatggttttgggggacatttttatcagcacttttgggacatcgtggc |
12675190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University