View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_30 (Length: 397)
Name: NF0412_high_30
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 56 - 98
Target Start/End: Complemental strand, 36941059 - 36941017
Alignment:
Q |
56 |
cattttttatgtcaaatatttttcatttgtttattccaattga |
98 |
Q |
|
|
||||||||||||||||||||||||||||||| |||| |||||| |
|
|
T |
36941059 |
cattttttatgtcaaatatttttcatttgttcattcaaattga |
36941017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University