View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_37 (Length: 382)
Name: NF0412_high_37
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 30 - 372
Target Start/End: Complemental strand, 40557845 - 40557505
Alignment:
| Q |
30 |
tggctcctgtttcttctcctgttgctgctacgtctgctgcttcggctggtgattctggaaacgctgatgcgcctcccaagaaacatagaggaaggccgcc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557845 |
tggctcctgtttcttctcctgttgctgctacgtctgctgcttcggctggtgattctggaaacgccgatgcgcctcccaagaaacatagaggaaggccgcc |
40557746 |
T |
|
| Q |
130 |
tggttctgggaagaagcagttagatgcgcttggtatgtggttttgtttctttagcactgacacttctgattgaaaggcgtgtttggtgtctctgacacat |
229 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||||| |||||| ||||||||| |||||||| |
|
|
| T |
40557745 |
tggctctgggaagaagcagttagatgcgcttggtatgtggttttgtttccttagcattgacatttctgattg-aaggcg-ccttggtgtctgtgacacat |
40557648 |
T |
|
| Q |
230 |
gtgattacatttaatttttgtaaattaccacctgacctgtcagtgtagtgtccggtgtctctagtattaatttaagcgcttaagtggttttttgaatgta |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40557647 |
gtgattacatttaatttttgtaaattaccacctgacgtgtcagtgtagtgtccggtgtctctagtattaatttaagcgcttaagtggttttttgaacgta |
40557548 |
T |
|
| Q |
330 |
gatggttctgatcgtgactcttttgttttttgtatgttctgtg |
372 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
40557547 |
gatggttctgattgtgacttttttgttttttgtatgttctgtg |
40557505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 785 times since January 2019
Visitors: 3065