View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_4 (Length: 572)
Name: NF0412_high_4
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 29 - 509
Target Start/End: Complemental strand, 23945544 - 23945065
Alignment:
| Q |
29 |
aaagatgtcatgtccccacttttattcacattgctcaagcttttannnnnnnnccgaattatcaccgctagaactagcaacatgagttggtttcccatta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945544 |
aaagatgtcatgtccccacttttattcacaccgctcaagcttttattttttg-ccgaattatcaccgctagaactagcaacatgagttggtttcccatta |
23945446 |
T |
|
| Q |
129 |
tttatgcctattttgcttgtaccaatatcacttctagttcnnnnnnnnnnnnnnnnncctactttaatgctagcattagaagagttaatttgggagggtt |
228 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23945445 |
tttatgcctatttttcttgtaccaatatcacttctagttcttttttgtttattttttcgtactttaatgcttgcattagaagagttaatttgggagggtt |
23945346 |
T |
|
| Q |
229 |
tgtacccgctcctattttcatgcatatgatcgtatttttcagcattcaattcattaattcttttcttaagattttgaaatgatgtacctttcatgtctgc |
328 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945345 |
tgtaaccgctccttatttcatgcatatgatcgtatttttcagcattcaattcattaattcttttcttaagattttgaaatgatgtacctttcatgtctgc |
23945246 |
T |
|
| Q |
329 |
accagcaatgcgtgacccagccttattgactcgnnnnnnnctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagata |
428 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945245 |
accagcaatgcgtgaaccaaccttattgactcgtttttttctttccactttaatccactcaccatgcaaagaatccggttcaccattaatacccaagata |
23945146 |
T |
|
| Q |
429 |
tcagttttgaacggaaactcctccatcattattcctgatttttcgtttttaccgttacccacattaaagttgttaccgttc |
509 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
23945145 |
tcagttttgaacggaatctcctccatcattattcctgatttttcgtttttaccgttacccacattaatgttgttatcgttc |
23945065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 560 times since January 2019
Visitors: 3061