View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_43 (Length: 378)
Name: NF0412_high_43
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 30 - 350
Target Start/End: Original strand, 40751689 - 40752009
Alignment:
Q |
30 |
atgagaatgcttgattcggacagattctgtagagaaatgatctatccgagcctttataaacattagatccttttcttgtgatgcaattatccggtaaaat |
129 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40751689 |
atgagaatgcttgatttggacagattctgtagagaaatgatctatccgagcctttataaacattagatccttttcttgtgatgcaattatccggtaaaat |
40751788 |
T |
 |
Q |
130 |
agtagaagcagtagtagtgtttggttttgttgacatagaagcaaaattccaagaggcaagagaactagaaggtgtattatcatagaatcttccattctca |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40751789 |
agtagaagcagtagtagtgtttggttttgttgacatagaagcaaaattccaagaggcaagagaactagaaggtgtattatcatagaatcttccattctca |
40751888 |
T |
 |
Q |
230 |
taatcaattcttgtggtgtaagggaaattaagtatagaggagttagaaaaaacttcttgaaaacttctcttgccacataacttggattgttccctttgtt |
329 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40751889 |
tatccaattcttgtggtgtaagggaaattaagtatagaggagttagaaaaaacttcttgaaaacttctcttgccacataacttggattgttccctttgtt |
40751988 |
T |
 |
Q |
330 |
ttctagccattataacatgcc |
350 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
40751989 |
ttctagccattataacatgcc |
40752009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1726 times since January 2019
Visitors: 3091