View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_54 (Length: 364)
Name: NF0412_high_54
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 167 - 357
Target Start/End: Complemental strand, 30691501 - 30691310
Alignment:
| Q |
167 |
ggcatacctatcaaggtgtaagatactattaacttgtaaactttgaggaagtaaggattcaatttaca--gtgttctttggcaacatataagtaaaatat |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||| |
|
|
| T |
30691501 |
ggcatacctatcaaggtgtaagatactattaacttgtaacctttgaggaagtaaggattcaatttacagtgtgttctttggcaacaaataagtaaactat |
30691402 |
T |
 |
| Q |
265 |
catgaagaagnnnnnnnnnctaaatctacccttttacaaaattactacatcaatccttatatatgatcccccaaccacgagtgagaattattt |
357 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30691401 |
catgaagaag-aaaataaactaaatctacccttttacaaaattactacatcaatccttatatatgataccccaaccacgagtgagaattattt |
30691310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University