View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_65 (Length: 349)
Name: NF0412_high_65
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_high_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 30 - 339
Target Start/End: Complemental strand, 43917779 - 43917470
Alignment:
Q |
30 |
atctttaaattttaaacaaggaaaaggtggatgggaagtatccagcatgacttttaactagtttaaaagttgtagttgttttagataacaggctggggcc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43917779 |
atctttaaattttaaacaaggaaaaggtggatgggaagtatccagcatgacttttaactagtttaaaagttgtagttgttttagataacaggctggggcc |
43917680 |
T |
 |
Q |
130 |
agggtatgacaaattggtgaggtggttggnnnnnnnagaacacgtctggaatataaatttggatgcgttttcagccgaaactcaacgaaagaaaagcaaa |
229 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||| |||||||| |||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
43917679 |
agggtatgacaaattggtgaggtggttggtttttttagaacacggctggaatagaaattttgatgcgttttcagccgaaactcaaccaaagaaaagcaaa |
43917580 |
T |
 |
Q |
230 |
ctctttttcttttgtttaacagaaattcgtgcaacaaggttacactgtgtttgattggaagtttcctcttttcctcgccttgtagacgatgcttggcctt |
329 |
Q |
|
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
43917579 |
ctctttttcttctgtttaacagaaattcatgcaacaaggttacactgtgtttgattggaagtttcgtcttttcctcaccttgtagacgatgcttggcctt |
43917480 |
T |
 |
Q |
330 |
aacctctctg |
339 |
Q |
|
|
||||| |||| |
|
|
T |
43917479 |
aacctttctg |
43917470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1322 times since January 2019
Visitors: 3080