View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_79 (Length: 314)
Name: NF0412_high_79
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_79 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 104 - 314
Target Start/End: Original strand, 27774770 - 27774981
Alignment:
| Q |
104 |
taccgtgataagatagataagctacacaaagagtt-aggtcacatatcatattgaattatgtgcatggcgtatgttcaaactgaatcacaccaagaaatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774770 |
taccgtgataagatagataagctacacaaagagtttaggtcacatatcatattgaattatgtgcatggcgtatgttcaaactgaatcacaccaagaaatt |
27774869 |
T |
 |
| Q |
203 |
gaacaagagttcccatagctgcagtctcacccctttgtagcagaagaagtgctagataattctcgtttcataagcttaattcccgagccaatttcctcaa |
302 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774870 |
gaacaagaaatcccatagctgcagtctcacccctttgtagcagaaaaagtgctagataattctcgtttcataagcttaattcccgagccaatttcctcaa |
27774969 |
T |
 |
| Q |
303 |
agcgaaggtaga |
314 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27774970 |
agcgaaggtaga |
27774981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 206 - 304
Target Start/End: Complemental strand, 27802226 - 27802129
Alignment:
| Q |
206 |
caagagttcccatagctgcagtctcacccctttgtagcagaagaagtgctagataattctcgtttcataagcttaattcccgagccaatttcctcaaag |
304 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||||||||||| ||| |||||| | ||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
27802226 |
caagagctcccatagctgcagtcccacctctttgtagcaga-gaaatgctagttcattctcgttccatacacttaattcccaagccaatttcctcaaag |
27802129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 27774695 - 27774734
Alignment:
| Q |
29 |
aaagccggcatttgggaggcagaggggaacaaggtcttgg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27774695 |
aaagccggcatttgggaggcagaggggaacaaggtcttgg |
27774734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University