View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_80 (Length: 313)
Name: NF0412_high_80
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 8822623 - 8822381
Alignment:
| Q |
1 |
caaaagcaaaactctggggcttctggttttgatgacgataaagaaaattgtggacaagctgataaaggtaaacaagtagaggagacaattaaatcggcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8822623 |
caaaagcaaaactctggggcttctggttttgatgacgataaagaaaattgcggacaagctgataaaggtaaacaagtagaggagacaattaaatcggcaa |
8822524 |
T |
 |
| Q |
101 |
ggttggaagaaaagaagtctcaaagagatgctcttgacggtaattctcctggtaaggttaagcagcaacattttgacgttgattctaaaatgaagattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8822523 |
ttttggaagaaaagaagtctcaaagagatgctcttgacggtaattctcctggtaaggttaagcagcgacattttgacgttgattctaaaatgaagattga |
8822424 |
T |
 |
| Q |
201 |
tgctgctgctactgagattgtaagtacttgcatagttcatctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8822423 |
tgctgctgctactgagattgtaagtacttgcatagttcatctc |
8822381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University