View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_high_93 (Length: 294)
Name: NF0412_high_93
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_high_93 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 34 - 294
Target Start/End: Complemental strand, 8447290 - 8447029
Alignment:
| Q |
34 |
agtacctgcatatcaagatcacgacatttctctcttcggtaagtaattcattcattaatt-aatcagttgcttcttacttaattaataatcaattagtat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447290 |
agtacctgcatatcaagatcacgacatttctctcttcggtaagtaattcattaattaatttaatcagttgcttcttacttaattaataatcaattagtat |
8447191 |
T |
 |
| Q |
133 |
tttcaattttaattgtataacatcagagtcaagagctatatgtcggtacgtatgtgagaaaaatagagagaaagggaacaaacaactgtatgatacaaat |
232 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
8447190 |
tttcaatttaaattgtataacatcagagtcaagagcgatatgtcggtacgtatgcgagaaaaatatagagaaagggaacaaacaactgtatggtacaaat |
8447091 |
T |
 |
| Q |
233 |
ccattggcaaaggcttcaatagatcaatggttagaagctgagggacaaagcttcaatccacc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8447090 |
ccattggcaaaggcttcaatagatcaatggttagaagctgaaggacaaagcttcaatccacc |
8447029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University