View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_102 (Length: 328)
Name: NF0412_low_102
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 95 - 290
Target Start/End: Original strand, 42849657 - 42849852
Alignment:
| Q |
95 |
tgatactgatattttctttgaacaaacacatatttttcaaatacacgcttaaaattttgaaatagacgtatgctgatggatagtctaattgatttcaaac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42849657 |
tgatactgatattttctttgaacaaacacatatttttcaaatacacgcttaaaattttgaaaaagacgtatgctgatggatagtctaattgatttcaaac |
42849756 |
T |
|
| Q |
195 |
acatgtttggttattaatgtggttcatattgatgctagatctcacttctttgatgtaagttggtacaatggactaattataatctgaatagtttat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42849757 |
acatgtttggttattaatgtggttcatattgatgctagatctaacttctttgatgtaagttggtacaatggactaattataatctgaatagtttat |
42849852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1610 times since January 2019
Visitors: 3090