View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_104 (Length: 323)
Name: NF0412_low_104
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_104 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 104 - 323
Target Start/End: Complemental strand, 3702230 - 3702011
Alignment:
| Q |
104 |
aatcaagggtttgaaacgaataactttgatctacttcttgggtagggaaactatgtataaaaatataatatttctcttcttcttgagaagcttccatgtt |
203 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
3702230 |
aatccagggtttgaaacgaataactttgatctacttcttgggtagggaaactatgtataaaaatagaatacttctcttcttcttgagaagcttccatgtt |
3702131 |
T |
 |
| Q |
204 |
ttttggattggttgtacttcatgtctttcaatttatgatatgccttaaaataatatgaagtgttaataccacacttaaatcatgaaataaataaatagtt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3702130 |
ttttggattggttgtacttcatgtctttcaatttatgatatgccttaaaataatatgaagtgttaataccacacttaaatcatgaaataaataaatagtt |
3702031 |
T |
 |
| Q |
304 |
aaaacttgataccattaaaa |
323 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3702030 |
aaaacttgataccattaaaa |
3702011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University