View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_105 (Length: 322)
Name: NF0412_low_105
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_105 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 131 - 226
Target Start/End: Original strand, 45906743 - 45906839
Alignment:
| Q |
131 |
actcaactattga-catgcacttccaacaattttatagctaaagtcgttagaaaaacttgtttagtgtcatataagaaaatagttattgttagcatt |
226 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45906743 |
actcaactattgatcatgcacttccaacaattttatagctaaagtcgttagaaaaacttgtttagtgtcatataagaaaatagttactgttagcatt |
45906839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 117 - 173
Target Start/End: Original strand, 43062015 - 43062072
Alignment:
| Q |
117 |
gaaatatagaagaaactcaactattga-catgcacttccaacaattttatagctaaag |
173 |
Q |
| |
|
||||||||||||||||||||||| ||| | |||||||||||||||| |||||||||| |
|
|
| T |
43062015 |
gaaatatagaagaaactcaactactgataaagcacttccaacaatttcatagctaaag |
43062072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 620 times since January 2019
Visitors: 3063