View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_107 (Length: 320)
Name: NF0412_low_107
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_107 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 36253631 - 36253475
Alignment:
| Q |
7 |
gaaaaggaccattttctaggtccttacaatgtggatgaagaccaaatggacaacattcccattgcacttgccgtttctgatgcatcccccgttgtgacgg |
106 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36253631 |
gaaaaggaccattttctatgtccatacaatgtggatgaagaccaaatggacaatattcccattgcacttgccgtttctgatgcatcccccgttgtgacgg |
36253532 |
T |
 |
| Q |
107 |
tggccatggctgcccccgcagatgacacaaacgcggcaacaaacacagccaccacct |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36253531 |
tggccatggctgcccccgcagatgacacaaacgcggcaacaaacacagccaccacct |
36253475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 252 - 320
Target Start/End: Original strand, 2298642 - 2298710
Alignment:
| Q |
252 |
aaatactatacatgttcaattaagatttatacttcacttcgctcaaaactatgatattctacgagtttt |
320 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
2298642 |
aaatactataaatgttcaattagtctttatacttcacttggctcaaaactatgttattctacgagtttt |
2298710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University