View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_111 (Length: 317)
Name: NF0412_low_111
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_111 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 83 - 236
Target Start/End: Original strand, 52761091 - 52761244
Alignment:
Q |
83 |
ccattaataatggacagtcaatagacccttcaacagatggttgttgaacttcaagctctctctggcgagttgctgcactaatttgtgccgaagagaaaaa |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52761091 |
ccattaataatggacagtcaatagacccttcaacagatggttgttgaacttcaagctctctctggcgagttgctgcactaatttgtgccgaagagaaaaa |
52761190 |
T |
 |
Q |
183 |
ctccccaacctaaaatggtaaaaacaaataaggaattataaacttgaatctaat |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52761191 |
ctccccaacctaaaatggtaaaaacaaataaggaattataaacttgaatctaat |
52761244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University