View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_114 (Length: 316)
Name: NF0412_low_114
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_114 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 75 - 316
Target Start/End: Complemental strand, 52577928 - 52577687
Alignment:
| Q |
75 |
gagatgaagcaaagggttggttagacaccacatacttatcgcattcaggaaaccttcgcatctcaagagggaataaggtgattaggcatttccaatataa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577928 |
gagatgaagcaaagggttggttagacaccacatacttatcgcattcaggaaaccttcgcatctcaagagggaataaggtgattaggcatttccaatataa |
52577829 |
T |
|
| Q |
175 |
acatcatcttaatatatagtcttttgttcctcccctcaattaaaatgcttgttcgtctagcacatcaaatcaaagcatttttataaaaacaatgtttcca |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577828 |
acatcatcttaatatatagtcttttgttcctcccctcaattaaaatgctagttcgtctagcacatcaaatcaaagcatttttataaaaacaatgtttcca |
52577729 |
T |
|
| Q |
275 |
agacttaacagcaacatatatatagtgaagggaaccacattt |
316 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52577728 |
agacttaacagcaacatatatatagtgcagggaaccacattt |
52577687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 696 times since January 2019
Visitors: 3064