View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_123 (Length: 313)

Name: NF0412_low_123
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_123
NF0412_low_123
[»] chr1 (1 HSPs)
chr1 (1-243)||(8822381-8822623)


Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 8822623 - 8822381
Alignment:
Q  1 caaaagcaaaactctggggcttctggttttgatgacgataaagaaaattgtggacaagctgataaaggtaaacaagtagaggagacaattaaatcggcaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  8822623 caaaagcaaaactctggggcttctggttttgatgacgataaagaaaattgcggacaagctgataaaggtaaacaagtagaggagacaattaaatcggcaa 8822524  T
Q  101 gtttggaagaaaagaagtctcaaagagatgctcttgacggtaattctcctggtaaggttaagcagcaacattttgacgttgattctaaaatgaagattga 200  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  8822523 ttttggaagaaaagaagtctcaaagagatgctcttgacggtaattctcctggtaaggttaagcagcgacattttgacgttgattctaaaatgaagattga 8822424  T
Q  201 tgctgctgctactgagattgtaagtacttgcatagttcatctc 243  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  8822423 tgctgctgctactgagattgtaagtacttgcatagttcatctc 8822381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University