View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_126 (Length: 309)
Name: NF0412_low_126
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_126 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 77 - 222
Target Start/End: Complemental strand, 8405822 - 8405677
Alignment:
| Q |
77 |
atgaacatataatatcattcatctacaagtattgcatgaatgacaaggtacacgattcaaaatctaagacttttgcgatccttcaaaacctgatcaactt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8405822 |
atgaacatataatatcattcatctacaagtattgcatgaatgacaaggtacacgattcaaaatctaagacttttgcgatccttcaaaacctgatcaactt |
8405723 |
T |
|
| Q |
177 |
tgtctaggtggaatttcatagacaatttgatctatcagtgatgatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8405722 |
tgtctaggtggaatttcatagacaatttgatctatcagtgatgatg |
8405677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1587 times since January 2019
Visitors: 3090