View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_126 (Length: 309)

Name: NF0412_low_126
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_126
NF0412_low_126
[»] chr8 (1 HSPs)
chr8 (77-222)||(8405677-8405822)


Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 77 - 222
Target Start/End: Complemental strand, 8405822 - 8405677
Alignment:
77 atgaacatataatatcattcatctacaagtattgcatgaatgacaaggtacacgattcaaaatctaagacttttgcgatccttcaaaacctgatcaactt 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8405822 atgaacatataatatcattcatctacaagtattgcatgaatgacaaggtacacgattcaaaatctaagacttttgcgatccttcaaaacctgatcaactt 8405723  T
177 tgtctaggtggaatttcatagacaatttgatctatcagtgatgatg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
8405722 tgtctaggtggaatttcatagacaatttgatctatcagtgatgatg 8405677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University