View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_129 (Length: 308)
Name: NF0412_low_129
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_129 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 69 - 292
Target Start/End: Original strand, 43589703 - 43589926
Alignment:
Q |
69 |
gagatgaagctagaattagggtctttttaattttataaattcattaaaatctatggattgtaataaaatcttataagtaaatgcattcttacattctttt |
168 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
43589703 |
gagatgaagctagaattagggtctttttaattttataaattcattaaaatctatggattgtaagaaaatcttataagtaaatgcattcttacattctttt |
43589802 |
T |
 |
Q |
169 |
aacatccacaaagcttttaatgtcgaaacaatccttttaaatccaaatctaatacccctccggccaaactttggattacttaggggtcttttcaaaaaac |
268 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43589803 |
aacatccacaaagcttttaatgtccaaacaatccttttaaatccaaatctaatacccctccggccaaactttggattacttaggggtcttttcaaaaaac |
43589902 |
T |
 |
Q |
269 |
tggaaggttgacaaaacagattgc |
292 |
Q |
|
|
|||||||||||||||| ||||||| |
|
|
T |
43589903 |
tggaaggttgacaaaaaagattgc |
43589926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University