View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_130 (Length: 308)
Name: NF0412_low_130
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_130 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 163 - 230
Target Start/End: Complemental strand, 9746568 - 9746500
Alignment:
Q |
163 |
gactatttatcaag-agatgttatctagttgatattttattcataaaaaattgcacgatacaagttcat |
230 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9746568 |
gactatttatcaaggagatgttatctagttgatattttattcataaaaaattgcacgatacaagttcat |
9746500 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University