View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_132 (Length: 304)
Name: NF0412_low_132
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_132 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 58 - 238
Target Start/End: Original strand, 35364511 - 35364689
Alignment:
| Q |
58 |
ttgcacatgactacttctctttaaataaccaaccatatatctttgatctatatcaaaatacatattcttcaatagaaaaatgaggacttttatgtcgata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364511 |
ttgcacatgactacttctctttaaataaccaaccatatatctttgatctat--caaaatacatattcttcaatagaaaaatgaggacttttatgtcgata |
35364608 |
T |
 |
| Q |
158 |
ttttttctttgctttgctagccaaattttgttgcattatttcctgtcatcagcaattactgttgcttttgctttgagttca |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364609 |
ttttttctttgctttgctagccaaattttgttgcattatttcctgtcatcagcaattactgttgcttttgctttgagttca |
35364689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 130 - 238
Target Start/End: Complemental strand, 10422070 - 10421959
Alignment:
| Q |
130 |
tagaaaaatgaggacttttatgtcgatattttttctttgctttgctagccaaattttgttgcattatttcctgtc---atcagcaattactgttgctttt |
226 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||| |||||||||| | |
|
|
| T |
10422070 |
tagaaaaatgaggacttatatgtcgatattttttctttgctttgctagccaaattttggtgtattatttcctgtcatcatcagcaactactgttgctcta |
10421971 |
T |
 |
| Q |
227 |
gctttgagttca |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10421970 |
gctttgagttca |
10421959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University