View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_134 (Length: 303)
Name: NF0412_low_134
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 104 - 225
Target Start/End: Complemental strand, 3702230 - 3702109
Alignment:
Q |
104 |
aatcaagggtttgaaacgaataactttgatctacttcttgggtagggaaactatgtataaaaatataatatttctcttcttcttgagaagcttccatgtt |
203 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
T |
3702230 |
aatccagggtttgaaacgaataactttgatctacttcttgggtagggaaactatgtataaaaatagaatacttctcttcttcttgagaagcttccatgtt |
3702131 |
T |
 |
Q |
204 |
ttttggattggttgtgcttcat |
225 |
Q |
|
|
||||||||||||||| |||||| |
|
|
T |
3702130 |
ttttggattggttgtacttcat |
3702109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 936 times since January 2019
Visitors: 3072