View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_139 (Length: 302)
Name: NF0412_low_139
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_139 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 50 - 231
Target Start/End: Original strand, 11224460 - 11224637
Alignment:
| Q |
50 |
atgaaggtatataaatttattttacaagcattctcttagaatctataaagatactaaaatgtccttataatatgtctttgacaccgagaatatttattta |
149 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11224460 |
atgaaggtatagaaatttattttacaagcattctcttagaatctataaagatactaaaatgtccttataatatgtctttgacaccgagaatatttattta |
11224559 |
T |
|
| Q |
150 |
cacaatctcatattctaaaaaactttgtcatacaagtattaactatcatagtttaaaattgtagaaacaaagtgagaagaat |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11224560 |
cacaatctcatattctaaaaaactatgtcatacaa----taactatcatagtttaaaattgttgaaacaaagtgagaagaat |
11224637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1381 times since January 2019
Visitors: 3081