View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_143 (Length: 300)
Name: NF0412_low_143
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_143 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 51 - 240
Target Start/End: Complemental strand, 42114952 - 42114763
Alignment:
| Q |
51 |
gtgcttcctgtgtctcctccatctaaaacaactccattctcttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaacaccagcc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42114952 |
gtgcttcctgtgtctcctccatctaaaacaactccattctcttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaacaccagcc |
42114853 |
T |
 |
| Q |
151 |
tcaagtataacaggttcatgctcttgctttaatatgtttataagacaaaactgcatcagtgtccttttaacttttcaattaagtcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42114852 |
tcaagtataacaggttcatgctcttgctttaatatgtttataagacaaaactgcatcagtgtccttttaacttttcaattaagtcctttg |
42114763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 75 - 142
Target Start/End: Complemental strand, 26450081 - 26450014
Alignment:
| Q |
75 |
aaaacaactccattctcttctatatttgctcttggtgctgttatggcttttgcatctggtcttgcaaa |
142 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| ||||||||| ||||||| || |||||||| |
|
|
| T |
26450081 |
aaaacaactccattctcttctatacttgcatttggtgttgttatggcctttgcatgtgtccttgcaaa |
26450014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University