View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_159 (Length: 289)
Name: NF0412_low_159
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_159 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 46 - 241
Target Start/End: Original strand, 39446057 - 39446252
Alignment:
Q |
46 |
gagtgatatgaaggtcaccggttcaactcttcaactcccccaggaaagtttattagaatccccacttttttatatgtagttgtccaacatcatttctttg |
145 |
Q |
|
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39446057 |
gagtgatatggaggtcactggttcaactcttcaactcccccaggaaagtttattagaatccccacttttttatatgtagttgtccaacatcatttctttg |
39446156 |
T |
 |
Q |
146 |
tcctgtaacttttgaaagttgcttcccgtacatttcaattaaaacaaaactcatccttaattctgccgtttcttctttgcttctcagtttcatttc |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39446157 |
tcctgtaacttttgaaagttgcttcccgtacatttcaattaaaacaaaactcatccttaattctgccgtttcttctttgcttctcagtttcatttc |
39446252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 961 times since January 2019
Visitors: 3072