View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_166 (Length: 287)
Name: NF0412_low_166
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_166 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 28 - 191
Target Start/End: Complemental strand, 7028452 - 7028289
Alignment:
| Q |
28 |
gagtgagatgaagaaacaaacttatgctactactggattcacaaattttcattttggagggagtctcaagatatctgcaaaatgaaaacaaaagtaggaa |
127 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
7028452 |
gagtgagataaagaaacaaacttatgctactactggattcacaaattttcattttggagggagcctcaagatatctgcaaaatgaaaagaatagtaggaa |
7028353 |
T |
|
| Q |
128 |
gaaaaaggcaacgaagtttactacttgatattggactgtatattataattgcctaatgagtaat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028352 |
gaaaaaggcaacgaagtttactacttgatattggactgtatattataattgcctaatgagtaat |
7028289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 225
Target Start/End: Complemental strand, 7028274 - 7028238
Alignment:
| Q |
189 |
aatattacaggtatgttgctatcttgtgaccataatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7028274 |
aatattacaggtatgttgctatcttgtgaccataatg |
7028238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 86
Target Start/End: Complemental strand, 7020787 - 7020746
Alignment:
| Q |
45 |
aaacttatgctactactggattcacaaattttcattttggag |
86 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7020787 |
aaacttatgctactactagattcacaatttttcattttggag |
7020746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 621 times since January 2019
Visitors: 3063