View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_168 (Length: 287)
Name: NF0412_low_168
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_168 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 86 - 216
Target Start/End: Complemental strand, 16565598 - 16565470
Alignment:
| Q |
86 |
ttccattagcattatcctttataaataaatatgctatttctaagcttgtttataaagcatattaacgatcaagnnnnnnnnnnnnnnnnnncatattcac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||| ||||||||| |
|
|
| T |
16565598 |
ttccattagcattatcctttataaataaatatggtatttctaagcttgtttataaagc--attaacaatcaagtttttttttttttcttttcatattcac |
16565501 |
T |
 |
| Q |
186 |
actacattctcctagttaatatgtagtattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16565500 |
actacattctcctagttaatatgtagtattt |
16565470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University