View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_178 (Length: 284)

Name: NF0412_low_178
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_178
NF0412_low_178
[»] chr7 (1 HSPs)
chr7 (40-227)||(734884-735071)


Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 40 - 227
Target Start/End: Complemental strand, 735071 - 734884
Alignment:
40 gtgagatgaagtcaccagaagcacctcaacaagggacaccatgcacttcaatgagcagaaagaaacttggtattttcttcattgagtctgaggatagaag 139  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
735071 gtgagatcaagtcaccagaagcacctcaacaagggacaccatgcacttcaatgagcagaaagaaacttggtattttcttcattgagtctgaggatagaag 734972  T
140 gatggctttagggcgaggttatacaagaggttctacacctgttaatattcatggaaaatccattgaggatctttcaaaaactggtggt 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
734971 gatggctttagggcgaggttatacaagaggttctacacctgttaatattcatggaaaatccattgaggatctttcaaaaactggtggt 734884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University