View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_182 (Length: 282)
Name: NF0412_low_182
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_182 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 73 - 257
Target Start/End: Complemental strand, 55205916 - 55205731
Alignment:
| Q |
73 |
attcagattaaaaataaacaaaacatcagnnnnnnn-aattaaaaaacaaaatagaggagaaacacgcgcttctcttcttcttctcacgtacatgaactt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||| |
|
|
| T |
55205916 |
attcagattaaaaataaacaaaacatcagttttttttaattaaaaaacaaaatagaggagaaacacgcgcttctcttcttcttctctcttacgtgaactt |
55205817 |
T |
 |
| Q |
172 |
tactcactctctgcttccctcagaatctcttcgtctccccctctcatcagcgccaacaaccaccgattgtgccgccgttcatctca |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55205816 |
tactcactctctgcttccctcggaatctcttcgtctccccctctcatcagcgccaacaaccaccgattgtgccgccgttcatctca |
55205731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 74 - 144
Target Start/End: Original strand, 55203379 - 55203449
Alignment:
| Q |
74 |
ttcagattaaaaataaacaaaacatcagnnnnnnnaattaaaaaacaaaatagaggagaaacacgcgcttc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55203379 |
ttcagattaaaaataaacaaaacatcagcttttttaattaaaaaacaaaatagaggagaaacacgcgcttc |
55203449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 74 - 257
Target Start/End: Complemental strand, 46513580 - 46513396
Alignment:
| Q |
74 |
ttcagattaaaaataaacaaaacatcagnnnnnnnaattaaaaaacaaaatagaggagaaacacgcgcttctcttcttcttct-cacgtacatgaacttt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||||| |||||| ||||| | |||| ||||| || |
|
|
| T |
46513580 |
ttcagattaaaaataaacaaaacatcagcttttttaattaaaaaaaaaaatagaggagaa-cacgcgcttgtcttct-cttcttctagtacgtgaacgtt |
46513483 |
T |
 |
| Q |
173 |
actcactctct---gcttccctcagaatctcttcgtctccccctctcatcagcgccaacaaccaccgattgtgccgccgttcatctca |
257 |
Q |
| |
|
|| | |||| | |||||||||||||||||||||||||||| ||||| |||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
46513482 |
acactctcttttgagcttccctcagaatctcttcgtctcccc-tctcaccagcaccaacaaccgccgattgtgtcgccgttcatctca |
46513396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 257
Target Start/End: Original strand, 10091686 - 10091757
Alignment:
| Q |
184 |
gcttccctcagaatctcttcgtctccccctctcatcagcgccaacaaccaccgattgtgccgccgttcatctca |
257 |
Q |
| |
|
|||||||||| || |||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10091686 |
gcttccctcaaaacctcttcgtttccc--tctcatcagcgccaacaaccgtcgattgtgccgccgttcatctca |
10091757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 257
Target Start/End: Original strand, 46164604 - 46164675
Alignment:
| Q |
184 |
gcttccctcagaatctcttcgtctccccctctcatcagcgccaacaaccaccgattgtgccgccgttcatctca |
257 |
Q |
| |
|
|||||||| |||| |||||||| |||| | |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46164604 |
gcttcccttagaacctcttcgtttccc--tgtcatcagcgccaacaaccgccgattgtgccgccgttcatctca |
46164675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 253
Target Start/End: Complemental strand, 26339928 - 26339860
Alignment:
| Q |
184 |
gcttccctcagaatctcttcgtctccccctctcatcagcgccaacaaccaccgattgtgccgccgttcat |
253 |
Q |
| |
|
||||||||| |||||||||| ||||||| |||||||| ||||||||| | ||||| | ||||||||||| |
|
|
| T |
26339928 |
gcttccctcggaatctcttcctctcccc-tctcatcaccgccaacaatcgtcgattattccgccgttcat |
26339860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 132 - 257
Target Start/End: Original strand, 48986130 - 48986260
Alignment:
| Q |
132 |
aaacacgcgcttctcttct--tcttctcacgtacatgaactttactcactctct-----gcttccctcagaatctcttcgtctccccctctcatcagcgc |
224 |
Q |
| |
|
||||||||||||||||||| |||||| | ||| ||||| |||| |||||||| |||||||| |||| |||||||| |||| | |||||||||| |
|
|
| T |
48986130 |
aaacacgcgcttctcttctcttcttctttcatacgtgaacgttacccactctcttttcagcttcccttagaacctcttcgtttccc--tgtcatcagcgc |
48986227 |
T |
 |
| Q |
225 |
caacaaccaccgattgtgccgccgttcatctca |
257 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |
|
|
| T |
48986228 |
caacaaccgccgattgtgtcgccgttcatctca |
48986260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 257
Target Start/End: Complemental strand, 10258387 - 10258339
Alignment:
| Q |
209 |
cccctctcatcagcgccaacaaccaccgattgtgccgccgttcatctca |
257 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||| || |||||||||||| |
|
|
| T |
10258387 |
cccctctcatcaccgccaccatccaccgattgtaccaccgttcatctca |
10258339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University