View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_184 (Length: 281)

Name: NF0412_low_184
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_184
NF0412_low_184
[»] chr4 (1 HSPs)
chr4 (14-243)||(27774433-27774662)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 14 - 243
Target Start/End: Complemental strand, 27774662 - 27774433
Alignment:
14 ttctagctcacgaggtgcaatgtcatttgctgctgctgctatggctggactgggatctgccaatagcagaggaatcagagggggaagagaccggcacggg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
27774662 ttctagctcacgaggtgcaatgtcatttgctgctgctgctatggctggacttggatctgccaatagcagaggaatcagagggggaagagaccggcacggg 27774563  T
114 cgtcccttgtttggtagttctaatgatcctccaaagttaatattcactgctggtgggaaacaattgaacagacagttgactatttatcaagcagttcaaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27774562 cgtcccttgtttggtagttctaatgatcctccaaagttaatattcactgctggtgggaaacaattgaacagacagttgactatttatcaagcagttcaaa 27774463  T
214 gacagcttgtacaagatgacgatgatgatg 243  Q
    ||||||||||||||||||||||||||||||    
27774462 gacagcttgtacaagatgacgatgatgatg 27774433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1124 times since January 2019
Visitors: 3076