View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_186 (Length: 280)
Name: NF0412_low_186
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_186 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 58 - 231
Target Start/End: Complemental strand, 29564110 - 29563937
Alignment:
| Q |
58 |
tttcagctactttatgccatcgatccggcgtatctttatcatgaactgcaagagcattttcaaatagtttgttctcttctggagtccagtttgtggccat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564110 |
tttcagctactttatgccatcgatccggcgtatctttatcatgaactgcaagagcattttcaaatagtttgttctcttctggagtccagtttgtggccat |
29564011 |
T |
|
| Q |
158 |
gttatcttccatacaccaattggagttttgtgtgtatgatgcaggaggtagaacttccatttcccacttcatct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29564010 |
gttatcttccatacaccaattggagttttgtgtgtatgatgcaggaggtagaacttccatttcccacttcatct |
29563937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 61 - 151
Target Start/End: Complemental strand, 25116124 - 25116034
Alignment:
| Q |
61 |
cagctactttatgccatcgatccggcgtatctttatcatgaactgcaagagcattttcaaatagtttgttctcttctggagtccagtttgt |
151 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||| ||||||||||||||||||||| | |||||||||| | |||||||| ||||| |
|
|
| T |
25116124 |
cagctaccttatgccaccgatccggcgtgtctttatcataaactgcaagagcattttcaaacaatttgttctctgcaggagtccattttgt |
25116034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1402 times since January 2019
Visitors: 3084