View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_198 (Length: 275)
Name: NF0412_low_198
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_198 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 30 - 216
Target Start/End: Original strand, 5893244 - 5893430
Alignment:
Q |
30 |
atgaatgaggtgcaacagtttgggttagggtctaacctaggtgattttattcctttatttagatggtttgattatagtggttaccataagaagataaaaa |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
5893244 |
atgaatgaggtgcaacagtttgggttagggtctaacctaggtgattttattcctttatttagatggtttgattttagtggttaccataagaagataaaaa |
5893343 |
T |
 |
Q |
130 |
gggttggggagaagatggatgcacttttccaaggacttcttgatgataatcgtaataatagaaaggaaaataagaataccatgattg |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5893344 |
tggttggggagaagatggatgcacttttccaaggacttcttgatgataatcgtaataatagaaaggaaaataagaataccatgattg |
5893430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University