View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_201 (Length: 274)

Name: NF0412_low_201
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_201
NF0412_low_201
[»] chr7 (1 HSPs)
chr7 (55-244)||(41824020-41824206)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 55 - 244
Target Start/End: Complemental strand, 41824206 - 41824020
Alignment:
55 gaagcaactggttttgtaggtggtgagaaaggaaacagcacatagttttggttagtgtgtgttttggaataataataagccacaagttttgtgtaaaact 154  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||    
41824206 gaagcaactggttttgtaggtggtgagaaaggaaacagcacatagttttggttagtgtgtgttttggaataataa---gccacaagttttgtgtaaaact 41824110  T
155 ggttgagcttactacttttactaccacgtccactgaaacgccgtttcaaagcgcgaacaatgatggattttatatacgtgtttcttttca 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
41824109 ggttgagcttactacttttactaccacgtccactgaaacgccgtttcaaagcgcgaacaatgatggattttgtatacgtgtttcttttca 41824020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University