View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_203 (Length: 273)
Name: NF0412_low_203
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_203 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 53 - 236
Target Start/End: Original strand, 5460429 - 5460613
Alignment:
Q |
53 |
gagtgaacataaggaagaaaa-agaaggctttatatagctcttattatgctttgttaagtgacaaaatagagatttggtaactttatttcatcttaattc |
151 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5460429 |
gagtgaacataaggaagaaaaaagaaggctttatatagctcttattatgctctgttaagtgacaaaatagagatttggtaactttatttcatcttaattc |
5460528 |
T |
 |
Q |
152 |
ggaggttatagtctcaaagatattcataatccttgagtaaataatctgtatgcctttaggcctaatcgatacctgttcaatcttc |
236 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5460529 |
ggaggttatagtctcaaagatattcataatccttgagtaaataatctgtatgcctttaggcctaatcgatacctgttcaatcttc |
5460613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1104 times since January 2019
Visitors: 3075