View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_205 (Length: 272)
Name: NF0412_low_205
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_205 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 52 - 234
Target Start/End: Original strand, 10121359 - 10121541
Alignment:
| Q |
52 |
ataggcatggtaataagacggcgtggagacgagttttaccttccctgtctcatctccaagagagtgtccgtaattataataactgagaaactttccatag |
151 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10121359 |
ataggcatggcaatgagacggcgtggagacgagttttaccttcactgtcccatctccaagagagtgtccgtaattataataactgagaaactttccatag |
10121458 |
T |
 |
| Q |
152 |
aaaagattagacgttagcaggaatttgcaccttccaaatccaattccaagagatattatatgtctgcttataacctttcttct |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10121459 |
aaaagattagacgttagcgagaatttgcaccttccaaatccaattccaagagatattatatgcctgcttataacctttcttct |
10121541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University