View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_21 (Length: 458)
Name: NF0412_low_21
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_21 |
 |  |
|
[»] scaffold0026 (2 HSPs) |
 |  |  |
|
[»] scaffold0684 (2 HSPs) |
 |  |  |
|
[»] scaffold0078 (2 HSPs) |
 |  |  |
|
[»] scaffold0024 (2 HSPs) |
 |  |  |
|
[»] scaffold0016 (2 HSPs) |
 |  |  |
|
[»] scaffold0160 (1 HSPs) |
 |  |  |
|
[»] scaffold0051 (2 HSPs) |
 |  |  |
|
[»] scaffold1001 (1 HSPs) |
 |  |  |
|
[»] scaffold0210 (2 HSPs) |
 |  |  |
|
[»] scaffold0003 (2 HSPs) |
 |  |  |
|
[»] scaffold0535 (2 HSPs) |
 |  |  |
|
[»] scaffold0119 (1 HSPs) |
 |  |  |
|
[»] scaffold0001 (3 HSPs) |
 |  |  |
|
[»] scaffold0811 (2 HSPs) |
 |  |  |
|
[»] scaffold0005 (4 HSPs) |
 |  |  |
|
[»] scaffold0712 (1 HSPs) |
 |  |  |
|
[»] scaffold0709 (1 HSPs) |
 |  |  |
|
[»] scaffold0578 (1 HSPs) |
 |  |  |
|
[»] scaffold0065 (2 HSPs) |
 |  |  |
|
[»] scaffold0056 (3 HSPs) |
 |  |  |
|
[»] scaffold0106 (2 HSPs) |
 |  |  |
|
[»] scaffold0021 (2 HSPs) |
 |  |  |
|
[»] scaffold0373 (1 HSPs) |
 |  |  |
|
[»] scaffold0370 (1 HSPs) |
 |  |  |
|
[»] scaffold0326 (4 HSPs) |
 |  |  |
|
[»] scaffold0166 (1 HSPs) |
 |  |  |
|
[»] scaffold0002 (4 HSPs) |
 |  |  |
|
[»] scaffold0179 (1 HSPs) |
 |  |  |
|
[»] scaffold0176 (2 HSPs) |
 |  |  |
|
[»] scaffold0159 (1 HSPs) |
 |  |  |
|
[»] scaffold0123 (1 HSPs) |
 |  |  |
|
[»] scaffold0007 (2 HSPs) |
 |  |  |
|
[»] scaffold0472 (1 HSPs) |
 |  |  |
|
[»] scaffold0347 (2 HSPs) |
 |  |  |
|
[»] scaffold0337 (1 HSPs) |
 |  |  |
|
[»] scaffold0011 (2 HSPs) |
 |  |  |
|
[»] scaffold0105 (1 HSPs) |
 |  |  |
|
[»] scaffold0204 (1 HSPs) |
 |  |  |
|
[»] scaffold0085 (1 HSPs) |
 |  |  |
|
[»] scaffold0060 (2 HSPs) |
 |  |  |
|
[»] scaffold0517 (2 HSPs) |
 |  |  |
|
[»] scaffold0009 (1 HSPs) |
 |  |  |
|
[»] scaffold0230 (1 HSPs) |
 |  |  |
|
[»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 222)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 308 - 450
Target Start/End: Complemental strand, 47114837 - 47114699
Alignment:
Q |
308 |
atgaataaaatatacctaggcataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtatttannnn |
407 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| | ||||| |||||||||||||| ||| |
|
|
T |
47114837 |
atgaataaaatatacctaggcataatttataataggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctgttttt----t |
47114742 |
T |
 |
Q |
408 |
nnnnngtcccttcaaatatgcatcgttttggttttgatctctg |
450 |
Q |
|
|
|||||| |||||||| ||||||||||||||||||||| |
|
|
T |
47114741 |
tttttgtccctgcaaatatgtctcgttttggttttgatctctg |
47114699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 234 - 309
Target Start/End: Original strand, 12821623 - 12821697
Alignment:
Q |
234 |
aattaaggcaagataattagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataagagat |
309 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
T |
12821623 |
aattaaggtaagataattagagggaaaatctaggttaacttataacat-acctaataagcatttagaataagagat |
12821697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 234 - 309
Target Start/End: Original strand, 12827265 - 12827339
Alignment:
Q |
234 |
aattaaggcaagataattagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataagagat |
309 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
T |
12827265 |
aattaaggtaagataattagagggaaaatctaggttaacttataacat-acctaataagcatttagaataagagat |
12827339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 332 - 397
Target Start/End: Original strand, 45002011 - 45002076
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
45002011 |
atttttaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 30106223 - 30106163
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
30106223 |
ataggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgta |
30106163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 20405225 - 20405166
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
T |
20405225 |
taggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgta |
20405166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 21159819 - 21159760
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
21159819 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
21159760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 474411 - 474353
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
474411 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 4035058 - 4034996
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
T |
4035058 |
taattggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgta |
4034996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 25615974 - 25616032
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
25616032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 393
Target Start/End: Original strand, 28942522 - 28942576
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagtt |
393 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
T |
28942522 |
ataggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtt |
28942576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 31480135 - 31480193
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
31480193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 35565507 - 35565565
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgta |
35565565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 9262158 - 9262105
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
9262158 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
9262105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 28552385 - 28552328
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
28552385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 49323782 - 49323839
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
49323839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 51550080 - 51550137
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 7588316 - 7588368
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagt |
7588368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 13584368 - 13584312
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 398
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 328 - 392
Target Start/End: Complemental strand, 29490757 - 29490693
Alignment:
Q |
328 |
cataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||| || |||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
29490757 |
cataatttttactaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29490693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 30130155 - 30130215
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
30130155 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
30130215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 47005521 - 47005469
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
47005521 |
taggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagt |
47005469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 47336584 - 47336524
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
47336584 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
47336524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 54608517 - 54608573
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 54608866 - 54608806
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
54608866 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
54608806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 28552019 - 28552078
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgta |
28552078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 29955668 - 29955609
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| |||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
29955668 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
29955609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 30004823 - 30004764
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| |||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
30004823 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
30004764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 30128282 - 30128341
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||| || || ||||||||||||||||||||| |
|
|
T |
30128282 |
taggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgta |
30128341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 51550448 - 51550389
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
51550448 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
51550389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 1721453 - 1721395
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
1721395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 4513262 - 4513320
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
4513320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 4950036 - 4950094
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
4950094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 12741272 - 12741214
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
12741214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 19844582 - 19844524
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
19844524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 37506864 - 37506922
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
37506864 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 40370589 - 40370539
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
40370539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 45002386 - 45002328
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgta |
45002328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 48924241 - 48924183
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||| |||||| ||| |||||||||||||| |||||| |
|
|
T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgta |
48924183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 127 - 200
Target Start/End: Original strand, 54544009 - 54544083
Alignment:
Q |
127 |
gcaaaatttgaaattcaaatttcaaatatggaaggagggaaa-ttttttaggattaaagtgattagcaattaatg |
200 |
Q |
|
|
|||||||||||||||||||||| | | || ||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
T |
54544009 |
gcaaaatttgaaattcaaatttaacaaatagaaagagggaaatttttttaagattaaagtgattagcaattaatg |
54544083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 3152113 - 3152056
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
3152113 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 3361817 - 3361768
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
3361768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 4034717 - 4034774
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4034774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 9261789 - 9261846
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
9261846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 9603626 - 9603679
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
9603626 |
ataggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
9603679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 12740905 - 12740962
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
12740905 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 25710870 - 25710813
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
25710813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 26090078 - 26090021
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
26090021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 29446209 - 29446156
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
29446209 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
29446156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 35407794 - 35407733
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| |||||||| |||||||| |||||| |
|
|
T |
35407794 |
aataggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgta |
35407733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 44802282 - 44802339
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | ||||||||||||||||||||| |
|
|
T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgta |
44802339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 474043 - 474099
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 3151748 - 3151800
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
3151748 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3151800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 336 - 392
Target Start/End: Complemental strand, 3387610 - 3387554
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| |||||||||||||||||||||| |||||||||| ||| |||||||||||||| |
|
|
T |
3387610 |
ataaaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagt |
3387554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 3830518 - 3830466
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
3830518 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3830466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 11463233 - 11463289
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgta |
11463289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 20612899 - 20612843
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 28427609 - 28427553
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 28452145 - 28452197
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagt |
28452197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 32119585 - 32119529
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 335 - 399
Target Start/End: Original strand, 35177248 - 35177312
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| ||||||||||||| ||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
T |
35177248 |
tataaaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgta |
35177312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 395
Target Start/End: Complemental strand, 36673244 - 36673192
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcc |
395 |
Q |
|
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcc |
36673192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 37507223 - 37507167
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 39437110 - 39437054
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 43441604 - 43441548
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 47336227 - 47336283
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 51834607 - 51834663
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 3830132 - 3830191
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
3830132 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
3830191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 339 - 390
Target Start/End: Complemental strand, 9603922 - 9603871
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
9603922 |
ataggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 14772210 - 14772261
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
14772261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 15979703 - 15979644
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
15979644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 20404888 - 20404947
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| | ||||||||||||||| ||| ||||||||||| ||||| |
|
|
T |
20404888 |
taggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagtttctgta |
20404947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 399
Target Start/End: Complemental strand, 35569146 - 35569079
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| ||| ||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
35569146 |
atttatataaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35569079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 40545562 - 40545621
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
40545562 |
taggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgta |
40545621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 50196301 - 50196356
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
50196356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 4322186 - 4322132
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
4322132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 5345690 - 5345632
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
5345632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 8940163 - 8940217
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| || |||||||||||||| |||||||||||||| |||||| |
|
|
T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgta |
8940217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 9597096 - 9597038
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgta |
9597038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 20644877 - 20644819
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||| |||||| ||||||| |||||| |
|
|
T |
20644877 |
aggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgta |
20644819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 391
Target Start/End: Original strand, 21553888 - 21553938
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
21553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 22008525 - 22008583
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
22008583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 22016043 - 22016101
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
22016101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 343 - 397
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 29686543 - 29686601
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| |||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgta |
29686601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 30268504 - 30268562
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30268562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 332 - 374
Target Start/End: Complemental strand, 39820673 - 39820631
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
39820673 |
atttaaaataggctaaaatatggttttggtccctgcaaatata |
39820631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 45320980 - 45320922
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45320922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 47005153 - 47005211
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgta |
47005211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 52342193 - 52342243
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
52342193 |
taggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 7957226 - 7957169
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgta |
7957169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 9863404 - 9863347
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| ||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
9863347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 16123139 - 16123196
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| ||||||| |||||| ||| |||||||||||||| |||||| |
|
|
T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
16123196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 25610129 - 25610080
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| ||| |||||| ||||||| |
|
|
T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
25610080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 332 - 397
Target Start/End: Original strand, 26799878 - 26799943
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||| |||||||||||||||||| ||||||| |||||| ||| |||||||||||||| |||| |
|
|
T |
26799878 |
atttttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 28452378 - 28452321
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| | | |||||||||||||| |||| |
|
|
T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 29445954 - 29446011
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29446011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 391
Target Start/End: Complemental strand, 29678387 - 29678338
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag |
29678338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 30034476 - 30034415
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| ||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
30034476 |
aataggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgta |
30034415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 341 - 390
Target Start/End: Original strand, 35936779 - 35936828
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| | |||||||||||| |
|
|
T |
35936779 |
aggctaaaatatggttttggtccctacaaatatacttcgttttggtttta |
35936828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 36672960 - 36673013
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||| |||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
36672960 |
ataggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagt |
36673013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 39288900 - 39288843
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
39288900 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 40370285 - 40370342
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgta |
40370342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 45313863 - 45313806
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| | | |||||| ||||||| |||||| |
|
|
T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgta |
45313806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 50196661 - 50196600
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| |||||| ||||||| ||| ||||| |||||||| |||||| |
|
|
T |
50196661 |
aataggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgta |
50196600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 51834944 - 51834887
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| | | |||||||||||||| |||| |
|
|
T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 53701663 - 53701606
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
53701606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 331 - 399
Target Start/End: Original strand, 12673633 - 12673701
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||| |||||||||||| ||||| ||||||| |||||| ||| |||||||||||||| |||||| |
|
|
T |
12673633 |
aattaataaaaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
12673701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 14633890 - 14633834
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||| ||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 27681685 - 27681625
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||| |||||||||| ||| |||||||||||| | |||||| |
|
|
T |
27681685 |
ataggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgta |
27681625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 28418899 - 28418843
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgta |
28418843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 28942906 - 28942850
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| || ||||||||||| ||| |||||||||||||| |||| |
|
|
T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 34238596 - 34238648
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34238648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 39436717 - 39436773
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||| | |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 334 - 397
Target Start/End: Original strand, 275436 - 275499
Alignment:
Q |
334 |
ttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||||| |||||||||| ||| ||| |||||| ||||||| |||| |
|
|
T |
275436 |
ttatcataggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 391
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 20611019 - 20611070
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
20611070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 338 - 397
Target Start/End: Original strand, 28427241 - 28427300
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| || ||||||||||| || |||||||||||||| |||| |
|
|
T |
28427241 |
aataggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 29955300 - 29955355
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
29955355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 30004454 - 30004509
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
30004509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 31869958 - 31869899
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
31869958 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgta |
31869899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 391
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 39288572 - 39288623
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
39288623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 46186772 - 46186721
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
46186721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 46751270 - 46751321
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
46751321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 47114486 - 47114537
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
47114537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 374
Target Start/End: Complemental strand, 47433875 - 47433836
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
47433875 |
tatattaggctaaaatatggttttggtccctgcaaatata |
47433836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 52342584 - 52342533
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||| |||||||||| ||| |||||||||||||| |
|
|
T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagt |
52342533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 344 - 390
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||||||||||||| | | |||||||||||| |
|
|
T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 4513621 - 4513563
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgta |
4513563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 340 - 402
Target Start/End: Complemental strand, 13514579 - 13514517
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtattt |
402 |
Q |
|
|
|||||||||||||| ||||||| ||||||||||| || |||||||||||||| | ||||||| |
|
|
T |
13514579 |
taggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgtattt |
13514517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 29678023 - 29678081
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgta |
29678081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 30424628 - 30424678
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagt |
30424678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 36732643 - 36732697
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| ||||||||||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
36732643 |
taaaataaggttttggtccctgcaaatatgtcttattttggttttagtttctgta |
36732697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 40277821 - 40277879
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||||| | | |||||||||||| | |||||| |
|
|
T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgta |
40277879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 49324149 - 49324091
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| |||||||||||||||||||||| |||||| || |||||||||||||| |||| |
|
|
T |
49324149 |
ataggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 390
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 19844265 - 19844322
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||| ||||||| ||| ||||| ||||||| |||||| |
|
|
T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgta |
19844322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 22155927 - 22155984
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||| ||||||| |||| |
|
|
T |
22155927 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 32119218 - 32119275
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||||||||||||||||||| || ||||| |||||||| |||| |
|
|
T |
32119218 |
taggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 39132908 - 39132875
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
39132908 |
taggctaaaatatggttttggtccctgcaaatat |
39132875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 46622131 - 46622074
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| | |||||||||||||| |||| |
|
|
T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 9596759 - 9596815
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| ||| |||||||||| | | |||||||||||||| |||||| |
|
|
T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgta |
9596815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 10977342 - 10977286
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| ||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 393
Target Start/End: Complemental strand, 40279336 - 40279284
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagtt |
393 |
Q |
|
|
|||||||||||||||||||||| ||||||||| ||||||||| |||||||| |
|
|
T |
40279336 |
aggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagtt |
40279284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 44506581 - 44506629
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
T |
44506581 |
aggctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 46901101 - 46901161
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||| | ||||||||||||||| ||||| |
|
|
T |
46901101 |
ataggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgta |
46901161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 342 - 398
Target Start/End: Complemental strand, 47902145 - 47902089
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||| ||||| ||||| |||||||| | |||||||||||||||| ||||| |
|
|
T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt |
47902089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 51500392 - 51500448
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||| | ||| ||| |||||| ||| |||||||||||||| |
|
|
T |
51500392 |
ataataggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagt |
51500448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 391
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||||| | |||||||||||||| ||| ||||||||||||| |
|
|
T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 53113442 - 53113474
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
53113442 |
aggctaaaatatggttttggtccctgcaaatat |
53113474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 53121301 - 53121357
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||||||||||||||||||| | |||| ||||||||| |||| |
|
|
T |
53121301 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
53121357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 329 - 392
Target Start/End: Original strand, 863268 - 863331
Alignment:
Q |
329 |
ataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||| |||||||||||||| ||||||||| ||||||||| || ||||| |||||||| |
|
|
T |
863268 |
ataatttattttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagt |
863331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 1721087 - 1721146
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||||||||||||| ||||||||| || ||||||||||||| |||||| |
|
|
T |
1721087 |
taggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgta |
1721146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 2486581 - 2486636
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| || ||||||||||||||| |||| |
|
|
T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttcatgta |
2486636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 7518089 - 7518140
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| || |||||||||||||| ||| ||||| |||||||| |
|
|
T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagt |
7518140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 7518444 - 7518389
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||||||||||||| || |||||||||||||||| |||| |
|
|
T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttcttgta |
7518389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 8555305 - 8555258
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||||||||| | | |||||||||||||| |
|
|
T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagt |
8555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 14772523 - 14772468
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| || | ||||||||||||| ||||||||||||| |||||| |
|
|
T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgta |
14772468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 15286155 - 15286206
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| | | |||||||||||||| |
|
|
T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagt |
15286206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 19656540 - 19656591
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||| ||||||| |
|
|
T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagt |
19656591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 20757403 - 20757450
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
20757450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 21159452 - 21159503
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |
|
|
T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
21159503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 25609765 - 25609824
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| | |||||| ||| |||||||||||||| |||||| |
|
|
T |
25609765 |
taggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgta |
25609824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 25710508 - 25710567
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| |||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
25710508 |
taggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
25710567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 373
Target Start/End: Original strand, 27681326 - 27681357
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
27681326 |
ggctaaaatatggttttggtccctgcaaatat |
27681357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 29525104 - 29525155
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||| |||||||| |
|
|
T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt |
29525155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 34238916 - 34238865
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||| |||||||| | | |||||||||||||| |
|
|
T |
34238916 |
aggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagt |
34238865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 38232240 - 38232291
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||||||||||||| || |||||| ||||||| |
|
|
T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagt |
38232291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||| ||||||| |||| |
|
|
T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 45006247 - 45006192
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| ||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
45006192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 863649 - 863595
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||| | |||||| ||||||| |||||| |
|
|
T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgta |
863595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 10778373 - 10778427
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| || |||||||||| ||| |||||| |||||||||||||| |
|
|
T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgta |
10778427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 338 - 392
Target Start/End: Complemental strand, 20907461 - 20907407
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| |||||||||||||| ||||||||||||| ||| ||||||||||||| |
|
|
T |
20907461 |
aataggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagt |
20907407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 344 - 390
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||| || |||||| ||| |||||||||||| |
|
|
T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 40545836 - 40545782
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| ||||||||||||||||||| || ||||||||||||| |||||| |
|
|
T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgta |
40545782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 40979711 - 40979653
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||| | |||||| |
|
|
T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgta |
40979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Original strand, 46026074 - 46026108
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
46026074 |
taggctaaaatatgtttttggtccctgcaaatata |
46026108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 51759818 - 51759876
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| | || ||||||||||| || |||||||||||||| |||||| |
|
|
T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgta |
51759876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 54437528 - 54437494
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
54437528 |
taggctaaaatatgtttttggtccctgcaaatata |
54437494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 395
Target Start/End: Complemental strand, 275833 - 275780
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcc |
395 |
Q |
|
|
|||||||||||| |||| ||||||| |||||| | | ||||||||||||||||| |
|
|
T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc |
275780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 374
Target Start/End: Original strand, 976767 - 976812
Alignment:
Q |
329 |
ataatttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||| ||||| |||||||||||||| ||||| |||||||||||||| |
|
|
T |
976767 |
ataaattatattaggctaaaatatgcttttgatccctgcaaatata |
976812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 11463480 - 11463431
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| |||| ||||||| || ||| |||||||||||||| |
|
|
T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagt |
11463431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 20644505 - 20644562
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||||||||||||||||| || ||||| ||||||| |||||| |
|
|
T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgta |
20644562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 39072213 - 39072156
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || ||||||||||| ||| |||||| ||||| | |||||| |
|
|
T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgta |
39072156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 40477434 - 40477401
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
40477434 |
aggctaaaatatgattttggtccctgcaaatata |
40477401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 373
Target Start/End: Original strand, 42446524 - 42446557
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| |
|
|
T |
42446524 |
taggctaaaatatgcttttggtccctgcaaatat |
42446557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 44507859 - 44507826
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
44507859 |
aggctaaaatatgattttggtccctgcaaatata |
44507826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 46186410 - 46186459
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||| |||||||||||||| ||| |||||| ||||||| |
|
|
T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
46186459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 50008921 - 50008970
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| |||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagt |
50008970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 50009284 - 50009227
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| |||||||||||||| ||||||||| ||| |||||| ||||| | |||||| |
|
|
T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgta |
50009227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 52403185 - 52403152
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| |
|
|
T |
52403185 |
taggctaaaatatgcttttggtccctgcaaatat |
52403152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 384
Target Start/End: Complemental strand, 53113757 - 53113716
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttg |
384 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
53113757 |
gctaaaatatggttttgatccatgcaaatatacctcgttttg |
53113716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 53701361 - 53701418
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || |||||||||| |||| |||| |||||||| |||||| |
|
|
T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgta |
53701418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 54767167 - 54767228
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| || ||| ||||||| || ||||||||||||| |||||| |
|
|
T |
54767167 |
aataggctaaaatatggttttattctctgaaaatatattttcttttggttttagtccctgta |
54767228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 278 - 310
Target Start/End: Complemental strand, 9460614 - 9460582
Alignment:
Q |
278 |
gcatgacctaataagcatttagaataagagatg |
310 |
Q |
|
|
|||||||||||||||||||||||||||| |||| |
|
|
T |
9460614 |
gcatgacctaataagcatttagaataagggatg |
9460582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 9863045 - 9863096
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| |||||||||||||| |||||||| ||||| ||| |||||||||||||| |
|
|
T |
9863045 |
taggttaaaatatggttttagtccctgc-aatatgcctcgttttggttttagt |
9863096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 374
Target Start/End: Original strand, 22508731 - 22508767
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
T |
22508731 |
aataggttaaaatatgattttggtccctgcaaatata |
22508767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Complemental strand, 26800170 - 26800138
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
26800170 |
aggctaaaatatggttttagtccctgcaaatat |
26800138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 30552479 - 30552423
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| ||||| |||| ||||||||| || |||||||||||||| |||| |
|
|
T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 34582523 - 34582579
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| ||||||||||||||||| | |||||||||||||| |||| |
|
|
T |
34582523 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 40169343 - 40169399
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||| ||||||| |||| |
|
|
T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 43440785 - 43440737
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagt |
43440737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 226
Target Start/End: Original strand, 43808758 - 43808798
Alignment:
Q |
186 |
gattagcaattaatgacatgttgttagagggaaaaattagg |
226 |
Q |
|
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
T |
43808758 |
gattagcaattaatgacagcttattagagggaaaaattagg |
43808798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 249 - 305
Target Start/End: Original strand, 43808780 - 43808836
Alignment:
Q |
249 |
attagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
||||||||||||| |||| | | | |||||||||||||||||||||||||| |||| |
|
|
T |
43808780 |
attagagggaaaaattagggttaatgatagcatgacctaataagcatttagagtaag |
43808836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||| ||||||||||||| || |||||| ||||||| |||| |
|
|
T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Original strand, 46104343 - 46104375
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
46104343 |
ggctaaaatatgattttggtccctgcaaatata |
46104375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 46724901 - 46724845
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || |||||||||| |||||||| ||||||| |||||| |
|
|
T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgta |
46724845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
Q |
342 |
ggctaaaatatggttttggtccc-tgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| ||||| ||||||||| | | |||||||||||||| |||| |
|
|
T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 52401016 - 52401048
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
52401016 |
aggctaaaatatgtttttggtccctgcaaatat |
52401048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 52708676 - 52708644
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
52708676 |
ggctaaaatatgcttttggtccctgcaaatata |
52708644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 8e-22; HSPs: 173)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 330 - 399
Target Start/End: Original strand, 25600218 - 25600287
Alignment:
Q |
330 |
taatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
T |
25600218 |
taatttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgta |
25600287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 11976372 - 11976430
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
11976430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 14495068 - 14495126
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
14495126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 4710222 - 4710165
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
4710222 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 7326421 - 7326364
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
7326364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 9496339 - 9496396
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 10776499 - 10776442
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
10776442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 11019859 - 11019802
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
11019859 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 16643659 - 16643716
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
T |
16643659 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 28346760 - 28346703
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
28346760 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 32726273 - 32726216
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 336 - 392
Target Start/End: Complemental strand, 24090494 - 24090438
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
24090494 |
ataatacgctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
24090438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 28346393 - 28346449
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 34963299 - 34963355
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 37536085 - 37536141
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 6469278 - 6469337
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
6469278 |
taggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgta |
6469337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 10337117 - 10337176
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
10337117 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10337176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 397
Target Start/End: Original strand, 19494115 - 19494174
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
T |
19494115 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 332 - 399
Target Start/End: Original strand, 20984136 - 20984203
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| | ||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
20984136 |
atttattaaaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgta |
20984203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 397
Target Start/End: Original strand, 35097324 - 35097383
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
35097324 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 397
Target Start/End: Complemental strand, 35347002 - 35346943
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
35347002 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 4474045 - 4473987
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgta |
4473987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 5357419 - 5357473
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
5357419 |
aataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
5357473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 7326083 - 7326141
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||| ||||||||| ||| |||||||||||||| |||| |
|
|
T |
7326083 |
ataggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 7420591 - 7420533
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgta |
7420533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 8298976 - 8298918
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8298918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 10540783 - 10540725
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
10540725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 10872914 - 10872972
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgta |
10872972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 16789074 - 16789132
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
16789132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 20277691 - 20277749
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgta |
20277749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 21064318 - 21064376
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgta |
21064376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 25131110 - 25131168
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
25131168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 25600598 - 25600540
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
25600540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 27341592 - 27341534
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
27341534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 28324182 - 28324124
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgta |
28324124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 331 - 389
Target Start/End: Complemental strand, 35115650 - 35115592
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||| ||||||||||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
T |
35115650 |
aattaataataggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 40066496 - 40066554
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||| ||||||||||||||| |
|
|
T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgta |
40066554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 43477162 - 43477220
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
43477220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 3511904 - 3511961
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| ||| |||||||||||||| |||| |
|
|
T |
3511904 |
taggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 3512268 - 3512211
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
3512268 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 4621354 - 4621297
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
4621297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 7186004 - 7185947
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
7185947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 8298587 - 8298644
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8298644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 10337451 - 10337394
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||| |
|
|
T |
10337451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 14239081 - 14239024
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 14489073 - 14489016
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
14489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 16789369 - 16789312
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
16789312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 42133154 - 42133097
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
42133097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 337 - 397
Target Start/End: Original strand, 1778559 - 1778619
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
1778559 |
taattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 7420229 - 7420285
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 9496724 - 9496668
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 11019519 - 11019575
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 13232562 - 13232510
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc |
13232510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 330 - 398
Target Start/End: Original strand, 14238739 - 14238807
Alignment:
Q |
330 |
taatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||| |||| |||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| |
|
|
T |
14238739 |
taattaataaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 17073804 - 17073864
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
T |
17073804 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
17073864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 17574466 - 17574406
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
T |
17574466 |
ataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
17574406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 335 - 399
Target Start/End: Complemental strand, 18549580 - 18549516
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| ||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
18549580 |
tataatagactaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgta |
18549516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 20278059 - 20278007
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
T |
20278059 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagt |
20278007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 21064686 - 21064634
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| |||| ||| |||||||||||||| |
|
|
T |
21064686 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagt |
21064634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 22917563 - 22917619
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 29158351 - 29158411
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
29158351 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
29158411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 32725906 - 32725962
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 1525808 - 1525859
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1525859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 2355886 - 2355937
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| | |||| |||||||||||||||||||||||||||||||| |
|
|
T |
2355886 |
aggctaaaatataggtttgatccctgcaaatataccttgttttggttttagt |
2355937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||| |
|
|
T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 333 - 396
Target Start/End: Original strand, 23939538 - 23939601
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||| ||||||||||||||||||||| |||||||||| || ||||| |||||||||||| |
|
|
T |
23939538 |
tttataattggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct |
23939601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 32418317 - 32418368
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32418368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 34963664 - 34963609
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 332 - 399
Target Start/End: Complemental strand, 40066830 - 40066763
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| | ||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
40066830 |
atttatatttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgta |
40066763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 328 - 399
Target Start/End: Original strand, 40844142 - 40844213
Alignment:
Q |
328 |
cataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| | ||||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
40844142 |
cataatttatctttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
40844213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 43727097 - 43727152
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| | |||||||| |||||||||||||| |
|
|
T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgta |
43727152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 1526175 - 1526117
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
1526175 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 13232201 - 13232255
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13232255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 15719656 - 15719706
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagt |
15719706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 20984511 - 20984453
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
20984453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 28497616 - 28497562
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
28497562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 29488111 - 29488053
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
29488053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 33526414 - 33526356
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 33636318 - 33636372
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
33636318 |
aataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
33636372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 40844532 - 40844478
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgta |
40844478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 44997930 - 44997988
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||| |||||| ||||| |||||||| |
|
|
T |
44997930 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgta |
44997988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 4375692 - 4375749
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
4375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 4473702 - 4473759
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
4473702 |
taggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 7272751 - 7272694
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| | |||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgta |
7272694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 11976738 - 11976681
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
11976738 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 18549198 - 18549251
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
18549198 |
ataggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
18549251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 29992304 - 29992243
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| ||||||||||||| ||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
29992304 |
aataggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgta |
29992243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 2728231 - 2728287
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| ||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 4017301 - 4017245
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||| |
|
|
T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 6146948 - 6146892
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
6146892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 8094843 - 8094791
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
8094791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 9175373 - 9175321
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| |||||||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
T |
9175373 |
taggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
9175321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 10540447 - 10540499
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||| |
|
|
T |
10540447 |
taggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagt |
10540499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 13154883 - 13154943
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||| ||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
13154883 |
ataggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgta |
13154943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 391
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||| |||||||||||||||||| ||| ||||||||||||| |
|
|
T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag |
13779483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 16644045 - 16643989
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 24955012 - 24954960
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
24955012 |
taggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt |
24954960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 389
Target Start/End: Complemental strand, 27117977 - 27117929
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 392
Target Start/End: Original strand, 27341248 - 27341308
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| |
|
|
T |
27341248 |
atttataataggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagt |
27341308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 38930301 - 38930357
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| || ||||||||||||||||||| |
|
|
T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 42132864 - 42132912
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 1685117 - 1685164
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1685164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 343 - 390
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 7272419 - 7272470
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
7272470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 400
Target Start/End: Original strand, 21125718 - 21125777
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtat |
400 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||||||||| | ||||||| |
|
|
T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtat |
21125777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 25702510 - 25702569
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||| |||||| ||| ||||| ||||||| |||||| |
|
|
T |
25702510 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgta |
25702569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 27117751 - 27117810
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
27117751 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgta |
27117810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 28497254 - 28497305
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||| ||||| |||||||| |
|
|
T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagt |
28497305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 35345619 - 35345560
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| || ||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
35345619 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgta |
35345560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 40492958 - 40493017
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| || ||||||||||| || |||||||||||||| |||||| |
|
|
T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgta |
40493017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 8094476 - 8094534
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||| || |||||||||||||| |||| |
|
|
T |
8094476 |
ataggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 9175011 - 9175069
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgta |
9175069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 22650463 - 22650521
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
22650521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 24187568 - 24187626
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgta |
24187626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 24815069 - 24815011
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||| || ||||||||||||| |||||| |
|
|
T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgta |
24815011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 25131447 - 25131397
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| || ||||||||||| ||| |||||||||||||| |
|
|
T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
25131397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 29158669 - 29158619
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt |
29158619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 42430120 - 42430070
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42430070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 5357762 - 5357713
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| ||||||||||||||||||| | | |||||||||||||| |
|
|
T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagt |
5357713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 6146517 - 6146566
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6146566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 392
Target Start/End: Original strand, 24814710 - 24814755
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagt |
24814755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 25702811 - 25702778
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
25702811 |
taggctaaaatatggttttggtccctgcaaatat |
25702778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 28399039 - 28398978
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
28399039 |
aataggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgta |
28398978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 390
Target Start/End: Complemental strand, 38930665 - 38930616
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||| |
|
|
T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 3680532 - 3680584
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgta |
3680584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 389
Target Start/End: Complemental strand, 3680802 - 3680754
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||| ||||| ||||||||||||| ||| ||||||||||| |
|
|
T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||| ||||| |
|
|
T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 24187898 - 24187842
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | |||||| ||||||| |||| |
|
|
T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 1408354 - 1408303
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||| |||||||| |
|
|
T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt |
1408303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 2811778 - 2811731
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2811731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 374
Target Start/End: Complemental strand, 10718510 - 10718475
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |
|
|
T |
10718510 |
ataggctaaaatatgcttttggtccctgcaaatata |
10718475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 13155253 - 13155194
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| || ||||||||||| || |||||||||||| | |||||| |
|
|
T |
13155253 |
taggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgta |
13155194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 13779151 - 13779206
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| ||||||||||||| || |||||||||||| | |||||| |
|
|
T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgta |
13779206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 14488715 - 14488766
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| ||||| ||||||| |||||| ||| |||||||||||||| |
|
|
T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagt |
14488766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 14496815 - 14496866
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| || ||||||||||| | | |||||||||||||| |
|
|
T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagt |
14496866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 28323848 - 28323899
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| | |||||||||||||| | | |||||||||||||| |
|
|
T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagt |
28323899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 29991918 - 29991965
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||| ||| ||||| |||||||| |
|
|
T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagt |
29991965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 373
Target Start/End: Complemental strand, 30969717 - 30969686
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
30969717 |
ggctaaaatatggttttggtccctgcaaatat |
30969686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 338 - 397
Target Start/End: Complemental strand, 35143848 - 35143789
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| ||| || |||||| ||| |||||||||||||| |||| |
|
|
T |
35143848 |
aataggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 343 - 390
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||||||||| | || |||||||||||| |
|
|
T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 374
Target Start/End: Complemental strand, 38456792 - 38456757
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |
|
|
T |
38456792 |
ataggctaaaatatgcttttggtccctgcaaatata |
38456757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 1385616 - 1385582
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||| |||||||||||||||||||||||||||| |
|
|
T |
1385616 |
taggcttaaatatggttttggtccctgcaaatata |
1385582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 9832214 - 9832272
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| |||||||||||||| ||||||||| |||||||||||||| | |||||| |
|
|
T |
9832214 |
aggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgta |
9832272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Original strand, 10717119 - 10717153
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
10717119 |
taggctaaaatatgcttttggtccctgcaaatata |
10717153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 344 - 390
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 14495389 - 14495340
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| || ||||| |||||||| ||| |||||||||||||| |
|
|
T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagt |
14495340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 334 - 392
Target Start/End: Original strand, 14847817 - 14847875
Alignment:
Q |
334 |
ttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| ||| ||||||||| ||||| ||||||||||||| ||| ||||||||||||| |
|
|
T |
14847817 |
ttataaaaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagt |
14847875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 389
Target Start/End: Original strand, 23360444 - 23360478
Alignment:
Q |
355 |
ttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||||| ||||||||||||||| |
|
|
T |
23360444 |
ttttggtccctgcaaatatgccttgttttggtttt |
23360478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 397
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
Q |
355 |
ttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 26530667 - 26530725
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| |||||||||||| |||| ||||||||| ||| |||| ||||||||||||||| |
|
|
T |
26530667 |
aggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgta |
26530725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 33526052 - 33526102
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | | |||||||||||| |
|
|
T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt |
33526102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 33652193 - 33652247
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||| |||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgta |
33652247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 374
Target Start/End: Original strand, 36588212 - 36588254
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||| ||| ||||||||||||| |||||||||||||||||||| |
|
|
T |
36588212 |
atttttaaaaggctaaaatatgcttttggtccctgcaaatata |
36588254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 42429757 - 42429814
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||| ||||||| || | |||||||||||| |||||| |
|
|
T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcc-tcatttggttttagtccctgta |
42429814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 1408005 - 1408062
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||| ||||||||| || ||||| ||||||| ||||||| |
|
|
T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctgta |
1408062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 4376012 - 4375979
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||| |||||||||||||| |
|
|
T |
4376012 |
taggctaaaatatggttttagtccctgcaaatat |
4375979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtt |
387 |
Q |
|
|
||||||||| ||||||| |||||||||||||| ||| ||||||||| |
|
|
T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 374
Target Start/End: Original strand, 1376931 - 1376967
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||| ||||||| |||||||||||||||||||| |
|
|
T |
1376931 |
aataggcttaaatatgattttggtccctgcaaatata |
1376967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 1420501 - 1420469
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
1420501 |
ggctaaaatatgtttttggtccctgcaaatata |
1420469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 14197824 - 14197856
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
14197824 |
aggctaaaatatgtttttggtccctgcaaatat |
14197856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 15930933 - 15930989
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| ||||||| ||| ||||||| || |||||||||||||| |||||| |
|
|
T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgta |
15930989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 373
Target Start/End: Original strand, 17574105 - 17574133
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
17574105 |
taaaatatggttttggtccctgcaaatat |
17574133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 19962992 - 19963052
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || |||| ||||||||| || ||||| |||||||| |||||| |
|
|
T |
19962992 |
ataggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgta |
19963052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 28998052 - 28998020
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
28998052 |
ggctaaaatatgtttttggtccctgcaaatata |
28998020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 372
Target Start/End: Complemental strand, 30124284 - 30124252
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaata |
372 |
Q |
|
|
|||||||||||||| |||||||||||||||||| |
|
|
T |
30124284 |
taggctaaaatatgcttttggtccctgcaaata |
30124252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 30969399 - 30969455
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| | ||||||| | |||||||||||||| |||||| |
|
|
T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgta |
30969455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 39439923 - 39439955
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
39439923 |
aggctaaaatatgattttggtccctgcaaatat |
39439955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 3e-21; HSPs: 143)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 333 - 397
Target Start/End: Complemental strand, 20467727 - 20467663
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
20467727 |
tttagaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 3969014 - 3968952
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
3969014 |
taataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3968952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 12299141 - 12299083
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgta |
12299083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 1007513 - 1007452
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
1007513 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1007452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 25137360 - 25137300
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
25137360 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
25137300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 3414385 - 3414444
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3414444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 336 - 399
Target Start/End: Complemental strand, 10910970 - 10910907
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
10910970 |
ataataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10910907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 18024377 - 18024318
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
18024377 |
taggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
18024318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 19321133 - 19321074
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
T |
19321133 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgta |
19321074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 34582894 - 34582835
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
34582894 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgta |
34582835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 22543351 - 22543409
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
22543351 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 326 - 399
Target Start/End: Original strand, 17764993 - 17765066
Alignment:
Q |
326 |
ggcataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| | ||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
T |
17764993 |
ggcataatttaagaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgta |
17765066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 21994405 - 21994348
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
21994405 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 2615870 - 2615922
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
2615870 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
2615922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 8681117 - 8681061
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 21147401 - 21147461
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
21147401 |
ataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgta |
21147461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 1007122 - 1007181
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
1007122 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgta |
1007181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 21993781 - 21993844
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
21993781 |
ataataggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgta |
21993844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 2373178 - 2373236
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||| |||| |||||| |
|
|
T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 333 - 399
Target Start/End: Complemental strand, 7324201 - 7324135
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
7324201 |
tttataataggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
7324135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 19690392 - 19690450
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
19690450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 25136993 - 25137051
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgta |
25137051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 6412216 - 6412273
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
6412216 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 398
Target Start/End: Original strand, 6468309 - 6468366
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | |||||||||||||||| ||||| |
|
|
T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 7156162 - 7156105
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 397
Target Start/End: Original strand, 8680761 - 8680830
Alignment:
Q |
328 |
cataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||| ||||||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
8680761 |
catattttttaataggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 15962389 - 15962332
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
15962332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 332 - 397
Target Start/End: Original strand, 21385241 - 21385306
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||| ||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
21385241 |
atttttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 22543720 - 22543663
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
22543720 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 34582529 - 34582586
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
34582586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 389
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 3968644 - 3968700
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 6412580 - 6412524
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 8170153 - 8170101
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8170101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 15076205 - 15076149
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 21385585 - 21385529
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 24273827 - 24273883
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | ||||||||||||||||||| |
|
|
T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 24274132 - 24274076
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 337 - 397
Target Start/End: Original strand, 31198610 - 31198670
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
31198610 |
taatgggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 33801744 - 33801688
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 3276355 - 3276304
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3276304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 9896638 - 9896587
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
9896587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 338 - 397
Target Start/End: Complemental strand, 12419942 - 12419883
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
12419942 |
aataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 12757609 - 12757660
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12757660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 13268108 - 13268159
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagt |
13268159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 13617531 - 13617586
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgta |
13617586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 25431856 - 25431797
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
25431797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 494405 - 494455
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
494455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 14656261 - 14656203
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgta |
14656203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 19129333 - 19129391
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||| ||||||| |||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
19129333 |
ataggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 333 - 399
Target Start/End: Complemental strand, 19296416 - 19296350
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||| ||||||||||||||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
19296416 |
tttaaaattggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
19296350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 21995063 - 21995121
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||| |||| ||| |||||||||||||| |||||| |
|
|
T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgta |
21995121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 24901239 - 24901289
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
24901289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 26376042 - 26375988
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 30928680 - 30928738
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
30928738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 343 - 397
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 32885670 - 32885728
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
32885670 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 1890454 - 1890397
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
1890454 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 336 - 397
Target Start/End: Complemental strand, 3414758 - 3414697
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||||||||||| |||||| || |||||||||||||| |||| |
|
|
T |
3414758 |
ataaaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 12419705 - 12419758
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
12419705 |
ataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
12419758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 14655377 - 14655434
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| | | |||||||||||||| |||| |
|
|
T |
14655377 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 14655903 - 14655960
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| |||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgta |
14655960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 15962025 - 15962082
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||| |
|
|
T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 333 - 374
Target Start/End: Complemental strand, 20897565 - 20897524
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
20897565 |
tttataattggctaaaatatggttttggtccctgcaaatata |
20897524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 23628799 - 23628848
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
23628848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 30929044 - 30928987
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30928987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 777676 - 777732
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||| || ||||||||||||||| |||||||||||||| |||| |
|
|
T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 7155796 - 7155852
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 14428651 - 14428707
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
14428707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 398
Target Start/End: Original strand, 19267565 - 19267621
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||||||||||| |||||| | | |||||||||||||| ||||| |
|
|
T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||| |||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 22822652 - 22822596
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 23770162 - 23770218
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
23770218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 30479421 - 30479365
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| | ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgta |
30479365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 346 - 397
Target Start/End: Original strand, 543365 - 543416
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 3356141 - 3356192
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
3356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3356448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 12176645 - 12176586
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
12176645 |
taggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
12176586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 12612361 - 12612302
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| || |||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
12612361 |
taggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgta |
12612302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 19129522 - 19129463
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
19129522 |
taggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgta |
19129463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 399
Target Start/End: Complemental strand, 21995435 - 21995368
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| | ||||||||||||||||| |||| ||||||||| ||| ||||||| |||||| |||||| |
|
|
T |
21995435 |
atttatatttggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgta |
21995368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 22792900 - 22792849
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| | |||||||||||||| ||| |||||||||||||| |
|
|
T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagt |
22792849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 24901556 - 24901497
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| ||||||||||| ||||||| ||| ||||||||||||| |||||| |
|
|
T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgta |
24901497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 25121498 - 25121439
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| | |||||||||||||| |||||| |
|
|
T |
25121498 |
taggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgta |
25121439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 234 - 305
Target Start/End: Complemental strand, 34704126 - 34704055
Alignment:
Q |
234 |
aattaaggcaagataattagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
|||||| || |||||||||||||||||| |||||| | | ||||| |||||||||||||||||||||||| |
|
|
T |
34704126 |
aattaatgctagataattagagggaaaaattaggtttagtagtagcaagacctaataagcatttagaataag |
34704055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 543726 - 543676
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| | |||||||||||||| |
|
|
T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta |
543676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 11449170 - 11449112
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| ||||||||| |||| |||||| |
|
|
T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgta |
11449112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 17771911 - 17771961
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
17771961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 18024014 - 18024068
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgta |
18024068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 23502541 - 23502483
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||| | |||||| |
|
|
T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgta |
23502483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 33131851 - 33131793
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgta |
33131793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 34990312 - 34990258
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
34990258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 318101 - 318040
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| | |||||||||||||| |||||| |
|
|
T |
318101 |
aataggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgta |
318040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 393
Target Start/End: Complemental strand, 778044 - 777991
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagtt |
393 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| ||||| ||||||||| |
|
|
T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtt |
777991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 344 - 397
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 10910629 - 10910686
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| || ||||||| || |||||||||||||| |||||| |
|
|
T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgta |
10910686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 11926037 - 11925976
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||| ||| |||||| | |||||||||||||||| |||| |
|
|
T |
11926037 |
aataggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttcttgta |
11925976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 395
Target Start/End: Original strand, 12611995 - 12612048
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcc |
395 |
Q |
|
|
|||||||||||||| || |||||||||||||| || |||||| ||||||||||| |
|
|
T |
12611995 |
ggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcc |
12612048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 354 - 399
Target Start/End: Complemental strand, 13617804 - 13617759
Alignment:
Q |
354 |
gttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
13617759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 24692981 - 24692924
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||| ||||||| |||| |
|
|
T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 31186591 - 31186534
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || ||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgta |
31186534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 1214998 - 1214946
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| || |||||||||| || |||||||||||||| |
|
|
T |
1214998 |
taggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt |
1214946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 6564945 - 6564894
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||||||||||||||||||||| || |||||||||||||| |
|
|
T |
6564945 |
taggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagt |
6564894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||| ||||| |||||||| ||| ||||||||||| |
|
|
T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 395
Target Start/End: Original strand, 15116671 - 15116724
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcc |
395 |
Q |
|
|
||||||||||||||||||| ||| |||||||||| || ||||||||||||||||| |
|
|
T |
15116671 |
taggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttcc |
15116724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 15722902 - 15722850
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| |||||| | ||||||||||| |||||| ||||||||||| |
|
|
T |
15722902 |
taggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagt |
15722850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 335 - 399
Target Start/End: Complemental strand, 19276046 - 19275982
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||| |||||||| ||||| |||||| ||||||||||| ||||||||||||| |||||| |
|
|
T |
19276046 |
tatactaggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctgta |
19275982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 159 - 227
Target Start/End: Original strand, 21544816 - 21544884
Alignment:
Q |
159 |
aggagggaaattttttaggattaaagtgattagcaattaatgacatgttgttagagggaaaaattaggt |
227 |
Q |
|
|
||||||||||||||||||| || | |||||||| ||||||||| || ||||||||||||||||||| |
|
|
T |
21544816 |
aggagggaaattttttagggttgtatggattagcatttaatgacagattattagagggaaaaattaggt |
21544884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| ||| |||||| ||||||| |||| |
|
|
T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 317810 - 317861
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||| ||||| |||||||||||||| || ||||||||||||| |
|
|
T |
317810 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 343 - 390
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 11448536 - 11448587
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
11448587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 12298825 - 12298872
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| || ||||| |||||||| |
|
|
T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagt |
12298872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 15722608 - 15722667
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || |||||| ||||||| |||||| |
|
|
T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgta |
15722667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 19320769 - 19320824
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| || ||||||||||| | |||||| |
|
|
T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgta |
19320824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 383
Target Start/End: Complemental strand, 23770441 - 23770398
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgtttt |
383 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
T |
23770441 |
taggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||| ||||||| |||| |
|
|
T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 397
Target Start/End: Original strand, 1214767 - 1214809
Alignment:
Q |
355 |
ttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctg |
1214809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Original strand, 3276365 - 3276399
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
3276365 |
taggctaaaatatgtttttggtccctgcaaatata |
3276399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 6564578 - 6564632
Alignment:
Q |
339 |
ataggctaaaatatggtttt-ggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||| || |||||||||||||| |
|
|
T |
6564578 |
ataggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagt |
6564632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 10091039 - 10091093
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
10091093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 17765376 - 17765318
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||| || ||||| ||||||| |||||| |
|
|
T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgta |
17765318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 19296107 - 19296165
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||||||| |||||||||||||| | | |||||| ||||||| |||||| |
|
|
T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgta |
19296165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Original strand, 21953204 - 21953238
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
21953204 |
taggctaaaatatgcttttggtccctgcaaatata |
21953238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 26375692 - 26375750
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||| | |||||| |
|
|
T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgta |
26375750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 339 - 373
Target Start/End: Original strand, 30479060 - 30479094
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| |
|
|
T |
30479060 |
ataggctaaaatatggttttggtccctgtaaatat |
30479094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 393
Target Start/End: Complemental strand, 6591440 - 6591391
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagtt |
393 |
Q |
|
|
||||||||||||||| || ||||||||||| || ||||||||||||||| |
|
|
T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtt |
6591391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 11129543 - 11129486
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| ||||||||||||| ||| ||||||||||| |||| |||| |
|
|
T |
11129543 |
ggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttcttgta |
11129486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 16995450 - 16995483
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
16995450 |
aggctaaaatatgtttttggtccctgcaaatata |
16995483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 17517370 - 17517337
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| |
|
|
T |
17517370 |
taggctaaaatatgtttttggtccctgcaaatat |
17517337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 345 - 374
Target Start/End: Complemental strand, 27765173 - 27765144
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
27765173 |
taaaatatggttttggtccctgcaaatata |
27765144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 34989962 - 34990011
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||| |||||||||||||| ||| |||||| ||||||| |
|
|
T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt |
34990011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 1214695 - 1214727
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
1214695 |
aggctaaaatattgttttggtccctgcaaatat |
1214727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 1890062 - 1890114
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| ||||||| |||||| ||| |||||| ||||||| |||| |
|
|
T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 8169784 - 8169844
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||||||||| ||||||||| |||||||| ||||| | |||||| |
|
|
T |
8169784 |
ataggctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctgta |
8169844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 14428948 - 14428900
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| |||| ||||||||| | | |||||||||||||| |
|
|
T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagt |
14428900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Complemental strand, 15117041 - 15117009
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
15117041 |
aggctaaaatatggttttagtccctgcaaatat |
15117009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Original strand, 18810532 - 18810564
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
18810532 |
ggctaaaatatgattttggtccctgcaaatata |
18810564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Original strand, 21165246 - 21165278
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
21165246 |
ggctaaaatatgcttttggtccctgcaaatata |
21165278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 31276339 - 31276283
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||||||||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgta |
31276283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 202)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 397
Target Start/End: Original strand, 47819220 - 47819287
Alignment:
Q |
330 |
taatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
47819220 |
taatttaaaataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 15516580 - 15516637
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
15516580 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 336 - 399
Target Start/End: Complemental strand, 33045696 - 33045633
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
33045696 |
ataaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
33045633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 234 - 305
Target Start/End: Complemental strand, 38506028 - 38505957
Alignment:
Q |
234 |
aattaaggcaagataattagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
|||||| ||||||| |||||||||||||| |||||||| | |||||||||||||||||||||||||||||| |
|
|
T |
38506028 |
aattaatgcaagattattagagggaaaatttaggttaagtggtagcatgacctaataagcatttagaataag |
38505957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 336 - 399
Target Start/End: Complemental strand, 39747841 - 39747778
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
39747841 |
ataataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
39747778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 335 - 397
Target Start/End: Original strand, 18473265 - 18473327
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
18473265 |
tataataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 24507844 - 24507786
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24507786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 35307714 - 35307772
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
35307772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 38151212 - 38151155
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
38151155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 48956066 - 48956009
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
48956009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 13770486 - 13770546
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
13770486 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
13770546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 22919681 - 22919741
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
22919681 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
22919741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 26324582 - 26324642
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
26324582 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
26324642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 38164296 - 38164240
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 44157696 - 44157752
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
44157752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 47819597 - 47819541
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 8140432 - 8140491
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
8140432 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
8140491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 397
Target Start/End: Complemental strand, 16026942 - 16026883
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
16026942 |
aataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 33045353 - 33045412
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
33045353 |
taggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgta |
33045412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 338 - 397
Target Start/End: Complemental strand, 41358667 - 41358608
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
T |
41358667 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 3247197 - 3247255
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
3247255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 333 - 399
Target Start/End: Original strand, 3753204 - 3753270
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||| |||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
3753204 |
tttaaaataagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
3753270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 7867358 - 7867300
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgta |
7867300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 12360969 - 12360911
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
12360911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 18302388 - 18302330
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
18302330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 19720711 - 19720769
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
19720769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 29072496 - 29072554
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29072554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 32626528 - 32626586
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
32626586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 33234545 - 33234603
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
33234603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 34002941 - 34002883
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgta |
34002883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 35056897 - 35056839
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35056897 |
ataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 45368489 - 45368547
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45368547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 990381 - 990324
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
990381 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 398
Target Start/End: Original strand, 1810926 - 1810983
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 3247564 - 3247507
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
3247564 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 10631164 - 10631221
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
10631221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 16060885 - 16060828
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
16060828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 332 - 397
Target Start/End: Original strand, 24977768 - 24977833
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||| || |||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
24977768 |
atttattattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 336 - 397
Target Start/End: Original strand, 30322923 - 30322984
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
30322923 |
ataaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 30323295 - 30323238
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
30323295 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 33000305 - 33000362
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
33000362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 35308111 - 35308054
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
35308054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 42483272 - 42483219
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
||||||||||||||||||||||||||||||||| | ||||||||||||| |||| |
|
|
T |
42483272 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttggttc |
42483219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 45380270 - 45380327
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
45380270 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 8140800 - 8140744
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| ||||||||||| ||| |||||||||||||| |||| |
|
|
T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 10631529 - 10631473
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 10887600 - 10887548
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
10887600 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10887548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 15526363 - 15526307
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 330 - 398
Target Start/End: Original strand, 21391084 - 21391152
Alignment:
Q |
330 |
taatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||| ||||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| |
|
|
T |
21391084 |
taatttattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 26061955 - 26062011
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 31061152 - 31061096
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 32729050 - 32728994
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 33000670 - 33000614
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 35005746 - 35005694
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
35005746 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35005694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 396
Target Start/End: Complemental strand, 45638896 - 45638840
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||| ||||| |
|
|
T |
45638896 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcct |
45638840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 4789310 - 4789365
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4789365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 7350733 - 7350686
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagt |
7350686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 11822003 - 11822054
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
11822054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 18473596 - 18473545
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18473545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 32454296 - 32454237
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| ||||||| |||||| |||||| |
|
|
T |
32454296 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgta |
32454237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 33379887 - 33379938
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33379938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 44158043 - 44157992
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagt |
44157992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 50429211 - 50429152
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
50429152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 50799128 - 50799187
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
50799187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 3679625 - 3679683
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
3679683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 6567497 - 6567439
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
6567439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 337 - 391
Target Start/End: Original strand, 12360598 - 12360652
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
T |
12360598 |
taataggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag |
12360652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 12361010 - 12361068
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||| | ||| |||||||||||||| |||||| |
|
|
T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgta |
12361068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 14007488 - 14007546
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
14007546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 15335292 - 15335238
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgta |
15335238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 18899842 - 18899896
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
18899896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 391
Target Start/End: Complemental strand, 24654168 - 24654118
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 24978123 - 24978065
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
T |
24978123 |
aggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgta |
24978065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 26442900 - 26442842
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgta |
26442842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 42482975 - 42483029
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
42482975 |
aataggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42483029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 3753573 - 3753516
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| ||| |||||||||||||| ||||| |
|
|
T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 10887231 - 10887288
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| | |||||||||||||| |||| |
|
|
T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 12322970 - 12322913
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||| | |||||| |
|
|
T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgta |
12322913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 13260323 - 13260266
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 15058419 - 15058468
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagt |
15058468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 24649350 - 24649399
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 29072862 - 29072805
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| | |||||||||||| |||||| |
|
|
T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgta |
29072805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 383
Target Start/End: Complemental strand, 32035792 - 32035747
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgtttt |
383 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
32035792 |
aataggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 33234912 - 33234855
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgta |
33234855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 336 - 373
Target Start/End: Original strand, 36912847 - 36912884
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
36912847 |
ataataggctaaaatatggttttggtccctgcaaatat |
36912884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 41738796 - 41738853
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||| |||||||| |||||| |
|
|
T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgta |
41738853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 44641079 - 44641128
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44641128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 44641432 - 44641375
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
44641375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 45290822 - 45290765
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
T |
45290822 |
taggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 52254479 - 52254422
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
52254422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 990087 - 990143
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||| ||||||| ||| |||||||||||||| |||| |
|
|
T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 7818783 - 7818839
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| ||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgta |
7818839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 19622653 - 19622705
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19622705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 19623018 - 19622962
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||| ||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 398
Target Start/End: Complemental strand, 22953556 - 22953500
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||| |||||||||||||| || ||||||||||||| |||||| |
|
|
T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctgt |
22953500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 26191353 - 26191409
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||| ||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
26191353 |
ataattggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
26191409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 31258338 - 31258394
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| ||| |||||||||||||| |||| |
|
|
T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 35005443 - 35005499
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 45290456 - 45290512
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 392
Target Start/End: Original strand, 46183686 - 46183734
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
46183734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 48609596 - 48609544
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48609544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 48955712 - 48955764
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
48955764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 332 - 399
Target Start/End: Complemental strand, 4565346 - 4565279
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||||||||| |||||||||||||||| || ||||| ||||||| |||||| |
|
|
T |
4565346 |
atttttaataggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgta |
4565279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 11822367 - 11822308
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgta |
11822308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 13259986 - 13260045
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||| |||||||||| || |||||||||||||| |||||| |
|
|
T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgta |
13260045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 15211510 - 15211561
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||| |||||| || |||||||||||||| |
|
|
T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
15211561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 16026572 - 16026623
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
16026572 |
aggctaaaatataattttggtccctgcaaatatccctcgttttggttttagt |
16026623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 16060595 - 16060645
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagt |
16060645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 17129691 - 17129746
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| | ||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgta |
17129746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 17984332 - 17984383
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagt |
17984383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 24649662 - 24649603
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| ||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
24649662 |
taggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
24649603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 26207280 - 26207335
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgta |
26207335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 29688429 - 29688378
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
29688378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||| |
|
|
T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| | | |||||| ||||||| |||| |
|
|
T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 52254182 - 52254233
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
52254233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 5058989 - 5058935
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||| ||| |||||| ||||||| |||||| |
|
|
T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgta |
5058935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 15058767 - 15058709
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||||| ||||||||||||| || |||||||||||||||| |||| |
|
|
T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttcatgta |
15058709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 15211858 - 15211812
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
|||||||||||||||||||||| ||||||||| ||| |||||||||| |
|
|
T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 344 - 390
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||| |
|
|
T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 17984701 - 17984651
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
17984651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 18079397 - 18079455
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| ||||||||||| ||||||||| ||| ||||||||||||| |||||| |
|
|
T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgta |
18079455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 18900130 - 18900076
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgta |
18900076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 26191734 - 26191684
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26191684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 338 - 392
Target Start/End: Complemental strand, 26324951 - 26324897
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| |||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
26324951 |
aataggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagt |
26324897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 26442563 - 26442613
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26442613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 343 - 397
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| ||||||||| || |||||||||||||| |||| |
|
|
T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 334 - 392
Target Start/End: Original strand, 34382939 - 34382996
Alignment:
Q |
334 |
ttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| | |||||||||||||||| |||||||||||||||||| | |||||||||||| |
|
|
T |
34382939 |
ttataaaatgctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagt |
34382996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 39025381 - 39025332
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| || ||| |||||||||||||| |
|
|
T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagt |
39025332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 48609235 - 48609293
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||| |||||||| || |||||||||||||| |||||| |
|
|
T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgta |
48609293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 340 - 402
Target Start/End: Complemental strand, 49923820 - 49923758
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtattt |
402 |
Q |
|
|
|||||||||||||| |||||||| |||||||||| | | |||||| ||||||| ||||||||| |
|
|
T |
49923820 |
taggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgtattt |
49923758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 4323829 - 4323878
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||| ||||||| |
|
|
T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
4323878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 347 - 392
Target Start/End: Complemental strand, 16083394 - 16083349
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||||||||||||||||| |||||| ||||||| |
|
|
T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagt |
16083349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 20948755 - 20948812
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||| ||||||| || |||| ||||||||| |||||| |
|
|
T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 22674200 - 22674253
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||||| ||||||||| || |||||||||||||| |
|
|
T |
22674200 |
ataggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt |
22674253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 25658014 - 25658071
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| |||||||| || |||||||||||| | |||||| |
|
|
T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgta |
25658071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 28507462 - 28507401
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| || |||| |||||||| |||||| |
|
|
T |
28507462 |
aataggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgta |
28507401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 41739122 - 41739066
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgta |
41739066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 390
Target Start/End: Original strand, 49073690 - 49073739
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || |||||||||||| |
|
|
T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 2939934 - 2939986
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgta |
2939986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 342 - 398
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||| ||||||| ||||| |
|
|
T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 7819105 - 7819053
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| || |||||||||| ||| |||||||||||||| |
|
|
T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagt |
7819053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 21383101 - 21383161
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||| |||||||| ||||| || |||||||||||||| |||||| |
|
|
T |
21383101 |
ataggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgta |
21383161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 22919979 - 22919927
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||| |||||||||| ||| ||||| |||||||| |
|
|
T |
22919979 |
taggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagt |
22919927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 27521577 - 27521633
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
27521633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| ||||| |||||||| |||| |
|
|
T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 34808194 - 34808254
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| |||||||||||||| |||||| ||||||| || |||||||||||||| |||||| |
|
|
T |
34808194 |
ataggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgta |
34808254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 37624745 - 37624793
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||| | |||||||||||||| ||| ||||||||||| |
|
|
T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 39303675 - 39303731
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||||||||| ||| || |||||||||||||| |||||| |
|
|
T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgta |
39303731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 41881092 - 41881148
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||| ||||||| || |||||||||||||| |||| |
|
|
T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 48730615 - 48730567
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| ||||||||| ||| ||||| |||||||| |
|
|
T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagt |
48730567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 7867127 - 7867186
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| || ||||| |||||||| |||||| |
|
|
T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgta |
7867186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| ||| |||||||||| | | |||||||||||||| |||| |
|
|
T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 384
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttg |
384 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||| |
|
|
T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 373
Target Start/End: Complemental strand, 24510308 - 24510277
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
24510308 |
ggctaaaatatggttttggtccctgcaaatat |
24510277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 374
Target Start/End: Complemental strand, 27264278 - 27264243
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |
|
|
T |
27264278 |
ataggctaaaatatgattttggtccctgcaaatata |
27264243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 374
Target Start/End: Original strand, 35721098 - 35721133
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |
|
|
T |
35721098 |
ataggctaaaatatgtttttggtccctgcaaatata |
35721133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 45368847 - 45368792
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| |||| ||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgta |
45368792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 332 - 374
Target Start/End: Original strand, 20722462 - 20722504
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||| ||||||||| || |||||||||||||||||||| |
|
|
T |
20722462 |
atttataattggctaaaatgtgcttttggtccctgcaaatata |
20722504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 30962413 - 30962471
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||| ||||||||||||||||| | |||||||||||||| |||| |
|
|
T |
30962413 |
ataggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 1159839 - 1159782
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| || | ||||||| | |||||||||||||||||| |||||| |
|
|
T |
1159839 |
ggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgta |
1159782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 8364918 - 8364869
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||| ||||||||||| |||||||| || ||||||||||| |
|
|
T |
8364918 |
taggctaaaatatagttttggtccccgcaaatatgtctcgttttggtttt |
8364869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 9774948 - 9774915
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
9774948 |
aggctaaaatatgcttttggtccctgcaaatata |
9774915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 17977619 - 17977586
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
17977619 |
aggcttaaatatggttttggtccctgcaaatata |
17977586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 20723748 - 20723715
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
20723748 |
aggctaaaatatgtttttggtccctgcaaatata |
20723715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 27262907 - 27262940
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
27262907 |
aggctaaaatatgtttttggtccctgcaaatata |
27262940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 33067346 - 33067395
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| || ||||||||||| |
|
|
T |
33067346 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 35911948 - 35911915
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
35911948 |
aggctaaaatatgcttttggtccctgcaaatata |
35911915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 37395632 - 37395665
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
37395632 |
aggctaaaatatgtttttggtccctgcaaatata |
37395665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 39163085 - 39163052
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| |
|
|
T |
39163085 |
taggctaaaatatgcttttggtccctgcaaatat |
39163052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 45979556 - 45979523
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
45979556 |
aggctaaaatatgtttttggtccctgcaaatata |
45979523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 337 - 373
Target Start/End: Complemental strand, 1811240 - 1811204
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||| |||| |||||||||||||| |
|
|
T |
1811240 |
taataggctaaaatatgattttagtccctgcaaatat |
1811204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Complemental strand, 4360627 - 4360595
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
4360627 |
aggctaaaatatggttttagtccctgcaaatat |
4360595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 337 - 373
Target Start/End: Original strand, 4617083 - 4617119
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||| |||||||||||||||||||||| |||||| |
|
|
T |
4617083 |
taataggttaaaatatggttttggtccctgaaaatat |
4617119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 11711312 - 11711280
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
11711312 |
ggctaaaatatgtttttggtccctgcaaatata |
11711280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 19198948 - 19198892
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || |||||||||| ||| ||||| ||||||| |||||| |
|
|
T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgta |
19198892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 22370378 - 22370338
Alignment:
Q |
186 |
gattagcaattaatgacatgttgttagagggaaaaattagg |
226 |
Q |
|
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
T |
22370378 |
gattagcaattaatgacagcttattagagggaaaaattagg |
22370338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 23470028 - 23469996
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
23470028 |
ggctaaaatatgtttttggtccctgcaaatata |
23469996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 26062255 - 26062203
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| ||||||| |||||| || |||||||||||||||||| |
|
|
T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 26699608 - 26699557
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| | | ||||| |||||||| |
|
|
T |
26699608 |
taggctaaaatatggttttggt-cctgcaaatatgcttcgtttttgttttagt |
26699557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 33067729 - 33067673
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| ||||| |||| ||||||||| || |||||||||||| |||||||| |
|
|
T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgta |
33067673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 34002634 - 34002682
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||| |||| ||||||||||||||||||| || ||||||||||| |
|
|
T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 37396899 - 37396867
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
37396899 |
ggctaaaatatgcttttggtccctgcaaatata |
37396867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 373
Target Start/End: Original strand, 39025112 - 39025140
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
39025112 |
taaaatatggttttggtccctgcaaatat |
39025140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 39747473 - 39747528
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| |||||||||| || |||||||||||||| |||| |
|
|
T |
39747473 |
aggctaaaatatggttttggt-cctgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 338 - 374
Target Start/End: Original strand, 46073881 - 46073917
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
T |
46073881 |
aataggctaaaatatgcttttgatccctgcaaatata |
46073917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 47038865 - 47038913
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||| |||| ||||||||||||||| || |||| |||||| |
|
|
T |
47038865 |
aggctaaaatatgtttttagtccctgcaaatatagctagtttgggtttt |
47038913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 50164402 - 50164434
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
50164402 |
aggctaaaatatgcttttggtccctgcaaatat |
50164434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 5e-20; HSPs: 203)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 50753925 - 50753979
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgta |
50753979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 6353637 - 6353581
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgta |
6353581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 13074127 - 13074075
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
13074127 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagt |
13074075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 338 - 397
Target Start/End: Complemental strand, 53916051 - 53915992
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
53916051 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 13530714 - 13530656
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
13530656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 24774044 - 24774102
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24774102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 398
Target Start/End: Original strand, 32365092 - 32365150
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
32365092 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 43231390 - 43231332
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
43231332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 341 - 398
Target Start/End: Original strand, 45505599 - 45505656
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 45505895 - 45505838
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 46115414 - 46115471
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
46115471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 46128548 - 46128605
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
46128605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 29499181 - 29499237
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 30046793 - 30046737
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 30061134 - 30061078
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 338 - 402
Target Start/End: Original strand, 35420387 - 35420451
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtattt |
402 |
Q |
|
|
||||| ||||||||||||||||||||| |||||||| | |||||||||||||||| ||||||||| |
|
|
T |
35420387 |
aatagtctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgtattt |
35420451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 37557194 - 37557138
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||| |
|
|
T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgta |
37557138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 13631226 - 13631285
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
13631226 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13631285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 14487800 - 14487859
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| || |||||| |
|
|
T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgta |
14487859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 35464016 - 35464075
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
35464016 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35464075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 51545628 - 51545679
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
51545679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 5827974 - 5827916
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgta |
5827916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 13064466 - 13064408
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
13064408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 16712692 - 16712634
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
16712634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 20291982 - 20292036
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
20291982 |
aataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
20292036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 25423923 - 25423981
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25423981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 25424313 - 25424255
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25424255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 335 - 397
Target Start/End: Original strand, 35763640 - 35763702
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35763640 |
tatattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 331 - 397
Target Start/End: Original strand, 43231077 - 43231143
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||| | ||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
43231077 |
aatttattaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 52017504 - 52017562
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
52017562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 52017871 - 52017813
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
52017813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 53915680 - 53915738
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
53915680 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 54903476 - 54903418
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgta |
54903418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 4211559 - 4211608
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 11693125 - 11693064
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
11693125 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgta |
11693064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 13073759 - 13073816
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13073816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 23778963 - 23779016
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |
|
|
T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc |
23779016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 339 - 392
Target Start/End: Original strand, 53716918 - 53716971
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
53716918 |
ataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
53716971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 53717174 - 53717117
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
53717117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 2322094 - 2322150
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgta |
2322150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 400
Target Start/End: Original strand, 4279020 - 4279080
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtat |
400 |
Q |
|
|
||||||||||||||||||| | ||||||||||||| || |||||||||||||| ||||||| |
|
|
T |
4279020 |
taggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgtat |
4279080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 13631600 - 13631544
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 14791807 - 14791751
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 29420539 - 29420487
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29420487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 333 - 397
Target Start/End: Original strand, 30060760 - 30060824
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| ||||| ||||||||||||||||||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
30060760 |
tttattataggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 335 - 399
Target Start/End: Original strand, 35119285 - 35119349
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
35119285 |
tataaaaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgta |
35119349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 41345852 - 41345908
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 51545972 - 51545912
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| |||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
51545972 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
51545912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 51763201 - 51763145
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| |||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgta |
51763145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 338 - 397
Target Start/End: Original strand, 123530 - 123589
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
123530 |
aataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 12152495 - 12152436
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||||||||| || |||||| |
|
|
T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgta |
12152436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 12791976 - 12791917
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
12791976 |
taggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgta |
12791917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 13064157 - 13064216
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
13064157 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
13064216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 13479613 - 13479554
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
13479554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 14488189 - 14488130
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
T |
14488189 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
14488130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 18205155 - 18205206
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18205206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 18205521 - 18205466
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
18205466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 23245597 - 23245538
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgta |
23245538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 32208541 - 32208592
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32208592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 35415633 - 35415578
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 42823774 - 42823833
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgta |
42823833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 45593588 - 45593529
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||| |||||||||| || ||||||||||||||||||||| |
|
|
T |
45593588 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgta |
45593529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 46292392 - 46292439
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 2034856 - 2034798
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |||||| |
|
|
T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgta |
2034798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 2180219 - 2180277
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
2180277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 2322433 - 2322375
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgta |
2322375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 336 - 390
Target Start/End: Original strand, 8904880 - 8904934
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||| |||||||||||| |||||||||||||||||||| ||| |||||||||||| |
|
|
T |
8904880 |
ataaaaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 9289263 - 9289321
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
9289263 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 22099543 - 22099593
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22099593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 26412187 - 26412245
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
26412187 |
ataggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 29463914 - 29463856
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| || |||||| |
|
|
T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgta |
29463856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 31812214 - 31812156
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||||||||| |||||| |
|
|
T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
31812156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 36054151 - 36054093
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| ||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
36054093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 38054549 - 38054603
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
38054603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 42824091 - 42824041
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt |
42824041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 42848026 - 42848084
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||||||||| |||||| |
|
|
T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
42848084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 55072388 - 55072446
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
55072446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 5827655 - 5827712
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
5827712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 13764613 - 13764670
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||| ||| |||||| |
|
|
T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgta |
13764670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 19321859 - 19321802
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
19321802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 331 - 392
Target Start/End: Complemental strand, 29380921 - 29380860
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||| ||| |||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
29380921 |
aatttttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29380860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 31560695 - 31560638
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
31560638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 32365484 - 32365427
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| ||||| |
|
|
T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 41324890 - 41324833
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| || |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgta |
41324833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 41619897 - 41619954
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 46088062 - 46088005
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 47532675 - 47532615
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
T |
47532675 |
aataggctaaa-tatggttttggtccttgcaaatatgtctcgttttggttttagttcctgta |
47532615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 52441759 - 52441820
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
52441759 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
52441820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 53308068 - 53308011
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgta |
53308011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 347 - 399
Target Start/End: Original strand, 2034544 - 2034596
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| ||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
2034596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 6827875 - 6827819
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 11285504 - 11285560
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
11285560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 12152151 - 12152211
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||| |||||||| |||||| |
|
|
T |
12152151 |
ataggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgta |
12152211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 18831181 - 18831121
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||||||||| ||||||| |||||| ||||||||||||||||| |||||| |
|
|
T |
18831181 |
atagactaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgta |
18831121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 19903653 - 19903605
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19903605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 336 - 392
Target Start/End: Original strand, 22584281 - 22584337
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||| |||| ||||||||| || |||||||||||||| |
|
|
T |
22584281 |
ataataggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
22584337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 398
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 31560330 - 31560386
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||| | | |||||||||||||| |||| |
|
|
T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 36050289 - 36050345
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||||| || |||||||||||||| |||||| |
|
|
T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgta |
36050345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 44925844 - 44925788
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| | |||||||| ||| |||||||||||||| |||||| |
|
|
T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgta |
44925788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 51708691 - 51708743
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
51708743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 51738134 - 51738194
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||| ||||||| || |||||||||||| | |||||| |
|
|
T |
51738134 |
ataggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgta |
51738194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 55072715 - 55072655
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| |||||||||||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
55072715 |
ataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
55072655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 5052585 - 5052534
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| ||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5052534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 5882550 - 5882608
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
5882550 |
taggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgta |
5882608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 6827545 - 6827596
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6827596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 343 - 390
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 399
Target Start/End: Complemental strand, 8760787 - 8760724
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||||||| |||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
8760787 |
ataaaaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgta |
8760724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 9445951 - 9446006
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
9446006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 338 - 397
Target Start/End: Original strand, 13530375 - 13530434
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| || |||||| ||||||| |||| |
|
|
T |
13530375 |
aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 14791502 - 14791549
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
14791549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 22099913 - 22099862
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
22099862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 24474964 - 24474913
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
24474913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 28809181 - 28809130
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
28809130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 30564835 - 30564890
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgta |
30564890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 34361802 - 34361853
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34361853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 37556839 - 37556898
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| | || ||||||||||||| | |||||||||||| |||||| |
|
|
T |
37556839 |
taggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgta |
37556898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 44925484 - 44925535
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
44925535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 46292652 - 46292601
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
46292601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 51709028 - 51708977
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
51708977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 52430102 - 52430043
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
52430102 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgta |
52430043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 54208822 - 54208775
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
54208775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 5063013 - 5063066
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||| ||||||||||||||||||||||||||||| ||| |||||| |
|
|
T |
5063013 |
taaaatatg-ttttagtccctgcaaatataccttgttttggtttaagtccctgta |
5063066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 5202919 - 5202977
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttg-ttttggttttagt |
392 |
Q |
|
|
|||||| || ||||||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
T |
5202919 |
tataattggttaaaatatggttttggtccctgcaaatatgcctcgtttttggttttagt |
5202977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 391
Target Start/End: Original strand, 20144423 - 20144469
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
20144469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 26314333 - 26314275
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||| |||||| || |||||||||||||| |||||| |
|
|
T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgta |
26314275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 31811924 - 31811982
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| | |||||||||||||| |||||| |
|
|
T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgta |
31811982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 35415296 - 35415354
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||| | | |||||||||||||| |||| |
|
|
T |
35415296 |
ataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 35763958 - 35763900
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||| |||| ||||||||| |||| ||| |||||||||||||| |||| |
|
|
T |
35763958 |
ataggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 36701999 - 36702057
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
36702057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 335 - 397
Target Start/End: Complemental strand, 46115786 - 46115724
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| |||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
46115786 |
tataaaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 335 - 397
Target Start/End: Complemental strand, 46128920 - 46128858
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| |||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
46128920 |
tataaaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 52442093 - 52442035
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgta |
52442035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 55805088 - 55805038
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||||||| | ||||||||| |||||||||||||||||| |
|
|
T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagt |
55805038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 8191391 - 8191334
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||| ||||| ||| |||||| |
|
|
T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgta |
8191334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 9289641 - 9289584
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||| |||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 373
Target Start/End: Original strand, 14594204 - 14594237
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
14594204 |
taggctaaaatatggttttggtccctgcaaatat |
14594237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 14594561 - 14594508
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| |||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgta |
14594508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 19321568 - 19321625
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| |||||||||||| ||| || ||| |||||||||||||| |||| |
|
|
T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 390
Target Start/End: Complemental strand, 20144732 - 20144683
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||| | ||||||||| ||| |||||||||||| |
|
|
T |
20144732 |
aggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 328 - 373
Target Start/End: Complemental strand, 30091128 - 30091083
Alignment:
Q |
328 |
cataatttataataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||| ||||||||| |
|
|
T |
30091128 |
cataatatattataggctaaaatatggttttggtccatgcaaatat |
30091083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 34355287 - 34355226
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| |||||| |||||| || |||||||||||||| |||||| |
|
|
T |
34355287 |
aataggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgta |
34355226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 339 - 388
Target Start/End: Complemental strand, 35119614 - 35119565
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
|||||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
T |
35119614 |
ataggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 47023107 - 47023050
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| | |||||||||||||| |||| |
|
|
T |
47023107 |
taggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 47136170 - 47136121
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
47136121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 51738413 - 51738364
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||||||||| ||||||||| ||| |||||| |||| |
|
|
T |
51738413 |
taggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt |
51738364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 390
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || |||||||||||| |
|
|
T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 55482468 - 55482411
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| |||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgta |
55482411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 3653742 - 3653690
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| ||| ||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
T |
3653742 |
tagggtaacatatgattttagtccctgtaaatataccttgttttggttttagt |
3653690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 11692760 - 11692812
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||||||||||||||||||||| || |||||| ||||||| |
|
|
T |
11692760 |
taggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagt |
11692812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 347 - 399
Target Start/End: Complemental strand, 27008401 - 27008349
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
27008349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 28448832 - 28448884
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||| | ||||||| ||| |||||||||||||| |
|
|
T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt |
28448884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 337 - 393
Target Start/End: Original strand, 31370799 - 31370855
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagtt |
393 |
Q |
|
|
|||||||||||||||||||||| || |||| ||||| ||| ||||||||||||||| |
|
|
T |
31370799 |
taataggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtt |
31370855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 36702362 - 36702306
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| || |||||| |||| ||| |||||||||||||| |||||| |
|
|
T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgta |
36702306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 41346220 - 41346168
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || ||||||||||||| |
|
|
T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
41346168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 41620257 - 41620201
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| | | |||||||||||||| |||| |
|
|
T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 339 - 390
Target Start/End: Complemental strand, 5797823 - 5797772
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||| ||||||||||||||||||||| ||||||| || |||||||||||| |
|
|
T |
5797823 |
ataggttaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 343 - 390
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 13764808 - 13764757
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||| |||||| | |||||||||||||| |
|
|
T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagt |
13764757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 22204055 - 22204110
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| |||||||||||||||||||| | |||| ||||||||| |||| |
|
|
T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
22204110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 22584609 - 22584550
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| ||||||| ||| |||||||||| | | |||||||||||||| |||||| |
|
|
T |
22584609 |
taggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgta |
22584550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| |||||||||||| |||||| || |||||||||||||| |||| |
|
|
T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 29463610 - 29463665
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| | ||||||||||| ||| |||||||||||| |||||| |
|
|
T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaattcctg |
29463665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 32208902 - 32208851
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||| ||||||| |
|
|
T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagt |
32208851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 35420701 - 35420646
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||| || | |||||||||||| |||||| |
|
|
T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgta |
35420646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 43368467 - 43368522
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
43368522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 45474597 - 45474546
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | | |||||||||||| |
|
|
T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt |
45474546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 45593226 - 45593285
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||| |||||| ||||||| ||| ||||||| |||||| |||||| |
|
|
T |
45593226 |
taggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgta |
45593285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 47022743 - 47022790
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||||||||| || |||||||||||||| |
|
|
T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47022790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 51830891 - 51830946
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| ||||| ||||||||| |||| ||||||||||||||||| |||||| |
|
|
T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgta |
51830946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 4279335 - 4279285
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagt |
4279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 5797484 - 5797538
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||||||| |||||||||| || |||||||||||||| |||||| |
|
|
T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgta |
5797538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 8760603 - 8760661
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgta |
8760661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 47135781 - 47135835
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| ||| |||||||| ||| ||||||| || ||||||||||||||||||||| |
|
|
T |
47135781 |
taaaacatgattttggtctctgtaaatatatctcgttttggttttagttcctgta |
47135835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 51762869 - 51762927
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||| |||||||||| | | ||||||||||||| |||||| |
|
|
T |
51762869 |
aggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgta |
51762927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 392
Target Start/End: Complemental strand, 123893 - 123848
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagt |
123848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 15555637 - 15555588
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||| ||||| |||||||||||||| || |||||||||||||| |
|
|
T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
15555588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 19903257 - 19903318
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||| ||||||||||||| || ||||| ||||||| |||||| |
|
|
T |
19903257 |
aataggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgta |
19903318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 398
Target Start/End: Complemental strand, 23779226 - 23779169
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || ||||||||||||| ||||| |
|
|
T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 26313988 - 26314045
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |||||| |
|
|
T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgta |
26314045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 390
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || |||||| ||||| |
|
|
T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 28809011 - 28809068
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||| ||||||||| | |||||||||||||| |||||| |
|
|
T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgta |
28809068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 370
Target Start/End: Original strand, 41324768 - 41324797
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaa |
370 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
41324768 |
aggctaaaatatggttttggtccctgcaaa |
41324797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 374
Target Start/End: Original strand, 41933805 - 41933850
Alignment:
Q |
329 |
ataatttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||| | |||||||||||||||| |||||||| ||||||||||| |
|
|
T |
41933805 |
ataattaaaaataggctaaaatatgattttggtctctgcaaatata |
41933850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 42358031 - 42358064
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
42358031 |
aggctaaaatatgtttttggtccctgcaaatata |
42358064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Complemental strand, 5259211 - 5259179
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
5259211 |
aggctaaaatatgtttttggtccctgcaaatat |
5259179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 8905234 - 8905186
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||||| |||||| ||| ||||| ||||| |
|
|
T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta |
8905186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 392
Target Start/End: Original strand, 16712331 - 16712379
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| ||||||||||||| ||| |||||||| ||||| |
|
|
T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagt |
16712379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 19675679 - 19675647
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
19675679 |
ggctaaaatatgcttttggtccctgcaaatata |
19675647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 27427871 - 27427926
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| | ||||||||||||| || |||||||||||||| |||| |
|
|
T |
27427871 |
aggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 374
Target Start/End: Original strand, 29059701 - 29059745
Alignment:
Q |
330 |
taatttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||| | ||||||||||||| |||| ||||||||||||||| |
|
|
T |
29059701 |
taatttattaaaggctaaaatatgtttttcgtccctgcaaatata |
29059745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 389
Target Start/End: Original strand, 29380667 - 29380715
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| || ||||||||||| |
|
|
T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 33137288 - 33137232
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| ||||| |||||||||||||| | |||| ||||||||| |||| |
|
|
T |
33137288 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctg |
33137232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 34659705 - 34659737
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
34659705 |
aggctaaaatatgcttttggtccctgcaaatat |
34659737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 42359405 - 42359373
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
42359405 |
ggctaaaatatgtttttggtccctgcaaatata |
42359373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 5e-20; HSPs: 169)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 16523330 - 16523268
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
16523330 |
taataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16523268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 10671628 - 10671687
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgta |
10671687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 2481558 - 2481500
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
2481500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 4423894 - 4423952
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
4423952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 16522990 - 16523048
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16523048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 18113088 - 18113146
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgta |
18113146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 29859873 - 29859815
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
29859815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 24358614 - 24358671
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
24358614 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 25705451 - 25705394
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
25705451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 40124966 - 40125023
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgta |
40125023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 332 - 397
Target Start/End: Original strand, 41451827 - 41451892
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
41451827 |
atttttaataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 10374775 - 10374831
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
10374831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 14003743 - 14003687
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 15842824 - 15842768
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 30215874 - 30215814
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
30215874 |
ataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgta |
30215814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 44559059 - 44559119
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
44559059 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
44559119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 334 - 397
Target Start/End: Original strand, 146318 - 146381
Alignment:
Q |
334 |
ttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| ||| |||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
146318 |
ttatattagactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 13215058 - 13215117
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
13215058 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
13215117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 330 - 397
Target Start/End: Original strand, 15842449 - 15842516
Alignment:
Q |
330 |
taatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| ||| |||| ||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
15842449 |
taattaatattaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 20658059 - 20658118
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
20658118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 329 - 392
Target Start/End: Original strand, 42695855 - 42695918
Alignment:
Q |
329 |
ataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||| ||| |||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
42695855 |
ataatttaaaattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
42695918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 4424186 - 4424128
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
4424128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 24483892 - 24483834
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
24483834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 25705084 - 25705142
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
25705142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 335 - 397
Target Start/End: Original strand, 30215415 - 30215477
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
30215415 |
tataaaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 33732861 - 33732919
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
33732919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 36815836 - 36815778
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||| |
|
|
T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgta |
36815778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 43788854 - 43788908
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
43788854 |
aataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
43788908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 9195054 - 9195111
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
9195111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 11788420 - 11788359
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
11788420 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
11788359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 14003407 - 14003464
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
14003407 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 16673773 - 16673716
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||| |
|
|
T |
16673773 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 20131315 - 20131372
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
20131315 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 26707869 - 26707930
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
26707869 |
aataggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgta |
26707930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 34317798 - 34317855
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgta |
34317855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 341 - 402
Target Start/End: Complemental strand, 35155620 - 35155559
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtattt |
402 |
Q |
|
|
|||||||||||||||||||||||||| |||||| ||||||||| ||||||| ||||||||| |
|
|
T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgtattt |
35155559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 38231431 - 38231488
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||| |
|
|
T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgta |
38231488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 16900207 - 16900151
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 16993598 - 16993542
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 19184152 - 19184096
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 20939324 - 20939268
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
20939268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 24358946 - 24358890
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 26814230 - 26814174
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 33576118 - 33576062
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 37271738 - 37271794
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 37272103 - 37272047
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 38980254 - 38980198
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 40302342 - 40302282
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
40302342 |
ataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgta |
40302282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 1137983 - 1138038
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| ||| ||||||||||| || |||||| |
|
|
T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgta |
1138038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 4042609 - 4042660
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
4042660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 9195208 - 9195149
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| | |||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgta |
9195149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 22881612 - 22881663
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22881663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 31644840 - 31644891
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
31644891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 43592044 - 43592103
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
43592103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 43597152 - 43597211
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| || ||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
43597152 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgta |
43597211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 44985623 - 44985678
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
44985678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 5006610 - 5006664
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||| || ||||||||||||||| ||||| |
|
|
T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgta |
5006664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 8046328 - 8046386
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgta |
8046386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 338 - 392
Target Start/End: Complemental strand, 10671945 - 10671891
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
10671945 |
aataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
10671891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 11713846 - 11713788
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
11713788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 16968555 - 16968609
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||| ||||||| |||||||||||||||||| |||||| |
|
|
T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgta |
16968609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 17302144 - 17302086
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||||||||| |||||| |
|
|
T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgta |
17302086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 27109073 - 27109123
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
27109123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 31225714 - 31225772
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||| |||||||||||||| |
|
|
T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgta |
31225772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 32476094 - 32476152
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgta |
32476152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 37911121 - 37911063
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||| | |||||| |
|
|
T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgta |
37911063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 38731828 - 38731886
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
38731886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 42358702 - 42358756
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
42358756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 43671933 - 43671991
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| | | ||||||||||||||||||||| |
|
|
T |
43671933 |
aggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgta |
43671991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 43672319 - 43672261
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||| |
|
|
T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgta |
43672261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 146690 - 146633
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
146633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 3838268 - 3838207
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
3838268 |
aataagctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
3838207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 8046648 - 8046591
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
8046591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 11713485 - 11713542
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
11713542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 328 - 397
Target Start/End: Original strand, 26813852 - 26813921
Alignment:
Q |
328 |
cataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||| | || ||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
26813852 |
cataatttttcattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 33575750 - 33575807
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
33575750 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 36622250 - 36622307
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
36622307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Complemental strand, 36806892 - 36806839
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
36806839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 41694003 - 41693946
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
41693946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 42696202 - 42696153
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
42696153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 398
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||| |||||||||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 16673410 - 16673466
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 17541381 - 17541437
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 19183781 - 19183837
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 23989836 - 23989888
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
23989888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 27311071 - 27311019
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagt |
27311019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 29865222 - 29865278
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29865278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 29865514 - 29865454
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||| | | |||||||||||||| |||||| |
|
|
T |
29865514 |
ataggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgta |
29865454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 31909480 - 31909429
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || | ||||||||||||| |
|
|
T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcc-tcttttggttttagt |
31909429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 33733241 - 33733193
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 393
Target Start/End: Complemental strand, 37229039 - 37228991
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagtt |
393 |
Q |
|
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagtt |
37228991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 38639410 - 38639462
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
38639462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 335 - 399
Target Start/End: Original strand, 40301968 - 40302032
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| |||||||||||||||||| |||||||||||||| ||| |||| |||||||| |||||| |
|
|
T |
40301968 |
tataaaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgta |
40302032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 44073808 - 44073752
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
44559359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 1138361 - 1138302
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
1138361 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgta |
1138302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 3172019 - 3172070
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagt |
3172070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 3172533 - 3172482
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||| ||||||||| ||| |||||||||||||| |
|
|
T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagt |
3172482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 248 - 303
Target Start/End: Complemental strand, 4814785 - 4814730
Alignment:
Q |
248 |
aattagagggaaaatctaggttaacttatagcatgacctaataagcatttagaata |
303 |
Q |
|
|
|||||||||||||| |||||||||| ||||||||||||||||||| || |||||| |
|
|
T |
4814785 |
aattagagggaaaaattaggttaactaatagcatgacctaataagctttaagaata |
4814730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| || |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 388
Target Start/End: Complemental strand, 23732329 - 23732282
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
|||||||||||||||||||||| |||||||||| ||| |||||||||| |
|
|
T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 388
Target Start/End: Original strand, 27310875 - 27310922
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 36622582 - 36622527
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| | | ||||||||||||||| ||||| |
|
|
T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtttctgta |
36622527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 37228732 - 37228783
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagt |
37228783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 44985986 - 44985927
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
44985986 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
44985927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 340 - 398
Target Start/End: Original strand, 3671001 - 3671059
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| ||| |||||| ||||||| ||||| |
|
|
T |
3671001 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 4042890 - 4042840
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt |
4042840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 340 - 398
Target Start/End: Complemental strand, 7814739 - 7814681
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| ||| ||||||||||||| ||||| |
|
|
T |
7814739 |
taggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 10665295 - 10665237
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| ||| |||||||||| | | ||||||||||||||||||||| |
|
|
T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgta |
10665237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 34318083 - 34318033
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||| ||||||| ||| |||||| ||||||| |
|
|
T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagt |
34318033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 337 - 391
Target Start/End: Complemental strand, 34964164 - 34964110
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||| || ||||| ||||||| |
|
|
T |
34964164 |
taattggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 40125290 - 40125232
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||||||||||| ||| |||| |||||||| |||||| |
|
|
T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgta |
40125232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 41693673 - 41693731
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
41693731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 1497610 - 1497667
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||| ||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgta |
1497667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 2412489 - 2412432
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| | |||| ||||||||| |||| |
|
|
T |
2412489 |
taggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
2412432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 3832640 - 3832587
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||| ||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
T |
3832640 |
ataggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagt |
3832587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 10375069 - 10375012
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||| | |||||| |
|
|
T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgta |
10375012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 12835325 - 12835382
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgta |
12835382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 13215367 - 13215318
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||| |||||||||||||||||| || ||||||||||| |
|
|
T |
13215367 |
taggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 18113454 - 18113397
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||| ||||||| | | |||||||||||| | |||||| |
|
|
T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgta |
18113397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 26239162 - 26239105
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||| ||||||| |||| |
|
|
T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 31226077 - 31226020
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| ||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgta |
31226020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 32691309 - 32691370
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| || |||||||||| ||| |||||||||||| | |||||| |
|
|
T |
32691309 |
aataggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgta |
32691370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 35686342 - 35686281
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| ||||||||||||||| |||||| |||||| | | ||||||||||||||| ||||| |
|
|
T |
35686342 |
aataggataaaatatggttttgatccctgtaaatatgcttcgttttggttttagtttctgta |
35686281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 2481192 - 2481248
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||| | ||||||||| || |||||||||||||| |||| |
|
|
T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 7814245 - 7814301
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| ||||| ||||||| |||||| ||| |||||||||||||| |||| |
|
|
T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 24483401 - 24483457
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgta |
24483457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 25300038 - 25299987
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
T |
25300038 |
ctaaaatatggttttggtccctgcaaatat-gtttcttttggttttagttcct |
25299987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 331 - 399
Target Start/End: Complemental strand, 29182453 - 29182385
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| | ||| |||||||||| ||||| ||||||||||||| || ||||||||||||||| ||||| |
|
|
T |
29182453 |
aatttagattagactaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgta |
29182385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata-ccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| ||||||||||||||| || |||||||||||||| |||| |
|
|
T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 186 - 226
Target Start/End: Complemental strand, 41579332 - 41579292
Alignment:
Q |
186 |
gattagcaattaatgacatgttgttagagggaaaaattagg |
226 |
Q |
|
|
|||||||||||||||||| ||| |||||||||||||||||| |
|
|
T |
41579332 |
gattagcaattaatgacaggttattagagggaaaaattagg |
41579292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 43789193 - 43789137
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| || ||||||||||| | | |||||||||||||| |||| |
|
|
T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 10664982 - 10665041
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||| | ||||| |||||| |
|
|
T |
10664982 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgta |
10665041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 13850881 - 13850834
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| ||||||||||| | | |||||||||||||| |
|
|
T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagt |
13850834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 17541777 - 17541726
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
17541726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 17912808 - 17912761
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| || ||||||||||| ||| |||||||||||||| |
|
|
T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
17912761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 26238807 - 26238870
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||| |||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
26238807 |
ataaaaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
26238870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 37910754 - 37910813
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||| ||||||||| ||| |||| |||||||| |||||| |
|
|
T |
37910754 |
taggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgta |
37910813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 40786458 - 40786517
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| || |||||||||| || |||||||||||||| |||||| |
|
|
T |
40786458 |
taggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgta |
40786517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 41791020 - 41791075
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||||||| |||||| ||| ||||||||||||| |||||| |
|
|
T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgta |
41791075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 2265398 - 2265340
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||| |||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgta |
2265340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 3837932 - 3837990
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgta |
3837990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 23732039 - 23732089
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| ||||| ||||||||||||| || |||||||||||||| |
|
|
T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
23732089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 339 - 373
Target Start/End: Original strand, 23861749 - 23861783
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||| ||||||||||||||||||| |
|
|
T |
23861749 |
ataggctaaaatatgtttttggtccctgcaaatat |
23861783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 25954423 - 25954369
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| |||| ||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgta |
25954369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Original strand, 25977868 - 25977902
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
25977868 |
taggctaaaatatgtttttggtccctgcaaatata |
25977902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 31326253 - 31326195
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| |||| ||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgta |
31326195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 41791312 - 41791266
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | |||||||||| |
|
|
T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 43597500 - 43597442
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||| |||||||| ||||| || |||||||||||||| |||||| |
|
|
T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgta |
43597442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 43710709 - 43710651
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||| | || ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgta |
43710651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 397
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||| ||| ||||||||| ||| |||||||||||||| |||| |
|
|
T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 1777468 - 1777501
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
1777468 |
aggctaaaatatgtttttggtccctgcaaatata |
1777501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 347 - 392
Target Start/End: Complemental strand, 4794468 - 4794423
Alignment:
Q |
347 |
aaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagt |
4794423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 343 - 392
Target Start/End: Original strand, 4842865 - 4842914
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||| || |||||||||||||| |
|
|
T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagt |
4842914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 13850518 - 13850579
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||| || |||||||||| || | |||||||||||| |||||| |
|
|
T |
13850518 |
aataggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgta |
13850579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 25979311 - 25979278
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
25979311 |
aggctaaaatatgtttttggtccctgcaaatata |
25979278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 31325920 - 31325977
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| | |||||||||||||| | | ||||| |||||||| |||||| |
|
|
T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgta |
31325977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 186 - 227
Target Start/End: Complemental strand, 39356751 - 39356710
Alignment:
Q |
186 |
gattagcaattaatgacatgttgttagagggaaaaattaggt |
227 |
Q |
|
|
|||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
39356751 |
gattagcaattaatgacagattattagagggaaaaattaggt |
39356710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 372
Target Start/End: Original strand, 15531027 - 15531059
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaata |
372 |
Q |
|
|
|||||||||||||| |||||||||||||||||| |
|
|
T |
15531027 |
taggctaaaatatgtttttggtccctgcaaata |
15531059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 17912447 - 17912499
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| ||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
17912499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 392
Target Start/End: Original strand, 35155298 - 35155342
Alignment:
Q |
348 |
aatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagt |
35155342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 36815485 - 36815545
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| | ||| |||||| || |||||||||||||| |||||| |
|
|
T |
36815485 |
ataggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgta |
36815545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 249 - 305
Target Start/End: Complemental strand, 41579310 - 41579254
Alignment:
Q |
249 |
attagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
||||||||||||| |||| | | | |||||||||||||||||||||||||| |||| |
|
|
T |
41579310 |
attagagggaaaaattagggttaatgatagcatgacctaataagcatttagagtaag |
41579254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 338 - 399
Target Start/End: Complemental strand, 82710 - 82649
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
82710 |
aataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
82649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 82340 - 82396
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 2662 - 2610
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
2662 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagt |
2610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 335 - 390
Target Start/End: Original strand, 2327 - 2382
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
2327 |
tataataggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 7e-19; HSPs: 181)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 337 - 397
Target Start/End: Complemental strand, 48192493 - 48192433
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
48192493 |
taataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 20388272 - 20388331
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
T |
20388272 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgta |
20388331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 336 - 399
Target Start/End: Complemental strand, 21554759 - 21554696
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||| |||||| |
|
|
T |
21554759 |
ataataggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgta |
21554696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 1614905 - 1614847
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1614847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 3975548 - 3975606
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
3975606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 9659690 - 9659632
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
9659632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 17999726 - 17999664
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
17999726 |
taataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
17999664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 23676455 - 23676397
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
23676455 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 26878074 - 26878016
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
26878074 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 29198300 - 29198358
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
29198300 |
ataggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 45228919 - 45228861
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
45228861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 46828943 - 46829001
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgta |
46829001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 8144660 - 8144603
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 16853589 - 16853532
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
16853532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 23399610 - 23399667
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
23399610 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 29198664 - 29198607
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 397
Target Start/End: Original strand, 1614550 - 1614614
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
1614550 |
tttattataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 3975840 - 3975788
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
3975840 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
3975788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 331 - 399
Target Start/End: Complemental strand, 12932794 - 12932726
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||||||| ||||||||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
12932794 |
aattgataataggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
12932726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 25988750 - 25988694
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 39266853 - 39266917
Alignment:
Q |
249 |
attagagggaaaatctaggttaacttatagcatgacctaataagcatttagaataagagatgaat |
313 |
Q |
|
|
||||||||||||| |||||||| | |||||| |||||||||||||||||||||||||||||||| |
|
|
T |
39266853 |
attagagggaaaaattaggttaaatgatagcaagacctaataagcatttagaataagagatgaat |
39266917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 44568325 - 44568381
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 5354766 - 5354825
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||| |||||| ||| |||||||||||||| |||||| |
|
|
T |
5354766 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgta |
5354825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 6589271 - 6589224
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagt |
6589224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 21223749 - 21223698
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
21223698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 35104297 - 35104238
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
35104297 |
taggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
35104238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 35838339 - 35838280
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
35838339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35838280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 41054238 - 41054179
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
41054238 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
41054179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 329 - 399
Target Start/End: Complemental strand, 5234217 - 5234147
Alignment:
Q |
329 |
ataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| | ||||||||||||||||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
T |
5234217 |
ataatttattaaaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgta |
5234147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 12894403 - 12894345
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
12894345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 13770082 - 13770024
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgta |
13770024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 19757747 - 19757805
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
19757805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 331 - 397
Target Start/End: Complemental strand, 25092559 - 25092493
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||| || ||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
25092559 |
aatttaaaaaaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 27458398 - 27458456
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
27458456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 28911907 - 28911849
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28911849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 37372905 - 37372847
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgta |
37372847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 336 - 397
Target Start/End: Original strand, 6108328 - 6108389
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
6108328 |
ataaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 25988383 - 25988440
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
25988383 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 28262709 - 28262770
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||| | |||||| |
|
|
T |
28262709 |
aataggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgta |
28262770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 28911573 - 28911634
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
28911573 |
aataggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgta |
28911634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 336 - 397
Target Start/End: Complemental strand, 44509060 - 44508999
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| |||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
44509060 |
ataaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 5233807 - 5233863
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 8144294 - 8144350
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 19561154 - 19561206
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||| |
|
|
T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc |
19561206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 23399977 - 23399921
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 25092159 - 25092215
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 332 - 392
Target Start/End: Complemental strand, 30223805 - 30223745
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||| ||||||||||||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
T |
30223805 |
atttatataaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagt |
30223745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 37527421 - 37527365
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgta |
37527365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 39438739 - 39438791
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
T |
39438739 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
39438791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 338 - 394
Target Start/End: Complemental strand, 45021860 - 45021804
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
T |
45021860 |
aataggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttc |
45021804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 46759656 - 46759708
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
46759656 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
46759708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 3807862 - 3807921
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgta |
3807921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 6589021 - 6589068
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 6892262 - 6892203
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||||||| |||||| |||||| |
|
|
T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgta |
6892203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 11767277 - 11767218
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| | | ||||||||||||| |||||| |
|
|
T |
11767277 |
taggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgta |
11767218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 16940756 - 16940819
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||| ||||||||||||||||||||||||| ||| | |||||||||||| |||||| |
|
|
T |
16940756 |
ataaaaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgta |
16940819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 333 - 392
Target Start/End: Original strand, 23816661 - 23816720
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| ||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
23816661 |
tttatattaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
23816720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||| |
|
|
T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 35837923 - 35837974
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35837974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 39832904 - 39832963
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
39832963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 48852443 - 48852494
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagt |
48852494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 2945846 - 2945788
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgta |
2945788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 5308687 - 5308630
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||| |||||||||||||||||| |||||||||||||| |||||| |
|
|
T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgta |
5308630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 338 - 392
Target Start/End: Complemental strand, 5355121 - 5355067
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| |||| |||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
5355121 |
aataggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagt |
5355067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 6509207 - 6509265
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgta |
6509265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 6509471 - 6509413
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
6509413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 346 - 392
Target Start/End: Original strand, 6954862 - 6954908
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagt |
6954908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 7431951 - 7432001
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7432001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 8555800 - 8555742
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
8555742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 16941049 - 16940995
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgta |
16940995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 340 - 398
Target Start/End: Original strand, 22539928 - 22539986
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||||||||| ||||| ||||||| ||| ||||||||||||||||||| |
|
|
T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 336 - 394
Target Start/End: Original strand, 25547247 - 25547305
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
|||||||| |||||||||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
T |
25547247 |
ataataggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc |
25547305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 329 - 399
Target Start/End: Original strand, 31732088 - 31732158
Alignment:
Q |
329 |
ataatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| || ||||||||||||||||| |||||||||||||| ||| |||||| ||||| | |||||| |
|
|
T |
31732088 |
ataatttattattggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgta |
31732158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 339 - 397
Target Start/End: Complemental strand, 35015223 - 35015165
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
35015223 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 41053841 - 41053899
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||| |||||| |
|
|
T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgta |
41053899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 44344790 - 44344732
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
44344732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 45073642 - 45073584
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
45073584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 6847122 - 6847069
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
T |
6847122 |
atagactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
6847069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 10357997 - 10358058
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| | || |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
10357997 |
aataggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgta |
10358058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 10358368 - 10358311
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
10358311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 17999465 - 17999522
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||||||||| || |||||| |
|
|
T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgta |
17999522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 18022707 - 18022654
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
18022707 |
ataggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
18022654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 19561450 - 19561393
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
19561393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 340 - 397
Target Start/End: Original strand, 23676130 - 23676187
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
23676130 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 35210515 - 35210458
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
35210458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 39833236 - 39833179
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| || ||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgta |
39833179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 46759942 - 46759885
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgta |
46759885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 48359075 - 48359018
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||||| |||| |
|
|
T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgta |
48359018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 351 - 399
Target Start/End: Complemental strand, 1271590 - 1271542
Alignment:
Q |
351 |
atggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
1271542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 6079810 - 6079866
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgta |
6079866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 389
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 332 - 392
Target Start/End: Original strand, 14543700 - 14543760
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||| || ||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
14543700 |
atttaaaaaaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
14543760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 30223460 - 30223516
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||| |||||||| || |||||||||||||| |||| |
|
|
T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 39439030 - 39438974
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 335 - 399
Target Start/End: Complemental strand, 39719649 - 39719585
Alignment:
Q |
335 |
tataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||||||||||||| |||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
39719649 |
tatattaggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgta |
39719585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 44568691 - 44568635
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||| || |||||||||||||| |||| |
|
|
T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 338 - 397
Target Start/End: Original strand, 9659351 - 9659410
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| || |||||| ||||||| |||| |
|
|
T |
9659351 |
aataggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 331 - 374
Target Start/End: Original strand, 12933408 - 12933451
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||| |||||||||||||||| |||||||||||||||||||| |
|
|
T |
12933408 |
aatttagaataggctaaaatatgcttttggtccctgcaaatata |
12933451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 337 - 392
Target Start/End: Original strand, 13769769 - 13769824
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| ||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
13769769 |
taattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
13769824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 32189388 - 32189333
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgta |
32189333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 35470282 - 35470223
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| |||||||| ||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
35470282 |
taggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgta |
35470223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 35665875 - 35665934
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
35665875 |
taggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 45073312 - 45073371
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
45073312 |
taggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgta |
45073371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 1559706 - 1559648
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| ||||| ||||||| |||||| |
|
|
T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgta |
1559648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 19783811 - 19783865
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||| || |||||||||||||| |
|
|
T |
19783811 |
aataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
19783865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 391
Target Start/End: Original strand, 38186369 - 38186415
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||| |||||| |
|
|
T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttag |
38186415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 39520397 - 39520455
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| | ||||||| || |||||||||||||| |||||| |
|
|
T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgta |
39520455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 44402959 - 44403017
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||||||||||| |||||| |
|
|
T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgta |
44403017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Original strand, 44841359 - 44841413
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgta |
44841413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 44958507 - 44958449
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||||||||| ||||||| || |||||||||||||| |||||| |
|
|
T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgta |
44958449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 45228612 - 45228670
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||| ||| ||||| |||||||| |||| |
|
|
T |
45228612 |
ataggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 390
Target Start/End: Complemental strand, 46648725 - 46648667
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||| | |||||||||||||||||| ||| |||||||||| ||| |||||||||||| |
|
|
T |
46648725 |
atttattaaaggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 1974009 - 1974066
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
1974066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 343 - 396
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||||||||||| ||||| |||||||| || |||||||||||||||||| |
|
|
T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct |
18022421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 20388675 - 20388618
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| ||| ||| |||||| ||| |||||| |||||||||||||| |
|
|
T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgta |
20388618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 333 - 374
Target Start/End: Complemental strand, 24197171 - 24197130
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||| |||||||||||||||| |||||||||||||||||||| |
|
|
T |
24197171 |
tttaaaataggctaaaatatgcttttggtccctgcaaatata |
24197130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 25547490 - 25547433
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
25547433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 390
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||| ||||||||||||| || |||||||||||| |
|
|
T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 37372441 - 37372494
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
37372494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 332 - 373
Target Start/End: Original strand, 40576756 - 40576797
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||| |||||||||||||||| ||||||||||||||||||| |
|
|
T |
40576756 |
atttaaaataggctaaaatatgcttttggtccctgcaaatat |
40576797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 46829312 - 46829255
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || ||||||||||||| |||||| |
|
|
T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgta |
46829255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 14739005 - 14738949
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||| ||||||| |||| |
|
|
T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 26877677 - 26877733
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| || |||||||||| || |||||||||||||| |||| |
|
|
T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| |||||||||||||| ||| |||||||||| ||| |||| |
|
|
T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 30709646 - 30709594
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
30709594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 31310363 - 31310415
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||| |||||||||||||| || |||||||||||||| |
|
|
T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagt |
31310415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 35104077 - 35104133
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| ||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 396
Target Start/End: Original strand, 38486476 - 38486532
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||||||||| |||||||||||| |||||| || ||||| |||||||||||| |
|
|
T |
38486476 |
taggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcct |
38486532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 38486792 - 38486740
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| |||||| |||||| || |||||||||||||| |
|
|
T |
38486792 |
taggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagt |
38486740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 399
Target Start/End: Complemental strand, 41365213 - 41365157
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| || || |||||||| ||| ||||||||||||||| ||||| |
|
|
T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtttctgta |
41365157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 332 - 392
Target Start/End: Original strand, 43300602 - 43300662
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||| ||||| |||||||||||||||| || ||||||||||| || |||||||||||||| |
|
|
T |
43300602 |
atttttaatatgctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt |
43300662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgtttt-ggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||| ||||||||| |||| |
|
|
T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 45671211 - 45671271
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||| |||||||||||||| |||| ||||||||| || ||||| ||||||||||||||| |
|
|
T |
45671211 |
ataggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgta |
45671271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 253 - 305
Target Start/End: Original strand, 48846903 - 48846955
Alignment:
Q |
253 |
gagggaaaatctaggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
||||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
T |
48846903 |
gagggaaaaattaggttaaactatagcaagacctaataagcatttagaataag |
48846955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 379
Target Start/End: Original strand, 2945510 - 2945557
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttg |
379 |
Q |
|
|
|||| |||||| |||||||||||| ||||||||||||||||| ||||| |
|
|
T |
2945510 |
atttttaatagcctaaaatatggtgttggtccctgcaaatatgccttg |
2945557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 17854151 - 17854206
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| || ||||||||||||| |||||| |
|
|
T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgta |
17854206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 28263069 - 28263014
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| ||||||||||||| |||||||| ||||||| |||||| |
|
|
T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgta |
28263014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||| ||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 388
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||| |
|
|
T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Original strand, 34877777 - 34877824
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||| |||||| || |||||||||||||| |
|
|
T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
34877824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 37952671 - 37952726
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| ||||||| |||||| ||| ||||||||||||| |||||| |
|
|
T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgta |
37952726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 37953048 - 37953001
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagt |
37953001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 399
Target Start/End: Complemental strand, 39520740 - 39520673
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||| ||| ||||||||||||||||||| ||||||||| || |||||| ||||||| |||||| |
|
|
T |
39520740 |
atttatataaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgta |
39520673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 43058752 - 43058807
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| ||||| |||||||||||||| ||||||||| ||||||| |||||| |
|
|
T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgta |
43058807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 46304085 - 46304136
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| |||| || ||||||||||| ||| |||||||||||||| |
|
|
T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagt |
46304136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 1007229 - 1007179
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||| ||||||| ||| |||||| ||||||| |
|
|
T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagt |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 5611568 - 5611534
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
5611568 |
taggctaaaatatgattttggtccctgcaaatata |
5611534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 21223405 - 21223455
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||| |||||||||||||| | | |||||||||||||| |
|
|
T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
21223455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 21554393 - 21554443
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||| ||||||| |||||| ||| |||||||||||||| |
|
|
T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt |
21554443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 248 - 305
Target Start/End: Complemental strand, 23487252 - 23487194
Alignment:
Q |
248 |
aattagagggaaaatct-aggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
|||||||||||||| | ||||||||| ||||||||||||||||||| || |||||||| |
|
|
T |
23487252 |
aattagagggaaaaaattaggttaactaatagcatgacctaataagctttaagaataag |
23487194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 23817035 - 23816977
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||| ||| |||||| || |||||||| |||||||||||| |
|
|
T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgta |
23816977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 24717532 - 24717482
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||| | ||||| || |||||||||||||| |
|
|
T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt |
24717482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 392
Target Start/End: Original strand, 24953828 - 24953870
Alignment:
Q |
350 |
tatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||| |||||||||||||| | |||||||||||||||| |
|
|
T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagt |
24953870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 370
Target Start/End: Complemental strand, 27037904 - 27037874
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaa |
370 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
27037904 |
taggctaaaatatggttttggtccctgcaaa |
27037874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 391
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||| |||||| |
|
|
T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 32197970 - 32197936
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
32197970 |
taggctaaaatatgcttttggtccctgcaaatata |
32197936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 398
Target Start/End: Original strand, 35210180 - 35210238
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
|||||||||||||| ||||| |||| |||||||| || |||||||||||||| ||||| |
|
|
T |
35210180 |
taggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 35469880 - 35469930
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagt |
35469930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 39719353 - 39719403
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||| ||||||| ||| ||||||||||||| |
|
|
T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagt |
39719403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 44403249 - 44403199
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||| ||||||||| || |||||||||||||| |
|
|
T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
44403199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 48854071 - 48854013
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| ||||| ||||||||||||| | |||||||||||||| |||||| |
|
|
T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgta |
48854013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 390
Target Start/End: Original strand, 1559342 - 1559391
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||| ||||| |||||||||||||| ||| |||||| ||||| |
|
|
T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 5308323 - 5308380
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||| ||||||||| || ||||| |||||||| |||||| |
|
|
T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgta |
5308380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 264 - 305
Target Start/End: Complemental strand, 23485724 - 23485683
Alignment:
Q |
264 |
taggttaacttatagcatgacctaataagcatttagaataag |
305 |
Q |
|
|
|||||||||| ||||||||||||||||||| || |||||||| |
|
|
T |
23485724 |
taggttaactaatagcatgacctaataagctttaagaataag |
23485683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 24195606 - 24195639
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
24195606 |
aggctaaaatatgtttttggtccctgcaaatata |
24195639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 28528905 - 28528962
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||| |||||| || |||| ||||||||| |||||| |
|
|
T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgta |
28528962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 390
Target Start/End: Original strand, 36684534 - 36684583
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||| |||| ||| |||||||||| || |||||||||||| |
|
|
T |
36684534 |
aggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 46304384 - 46304327
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| ||||| |||||||||||||| | |||||||||||||| |||||| |
|
|
T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgta |
46304327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 13418949 - 13418981
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
13418949 |
aggctaaaatatgtttttggtccctgcaaatat |
13418981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 19465983 - 19465924
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| | |||||||||||| || |||| ||||||||| |||||| |
|
|
T |
19465983 |
ataggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgta |
19465924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 389
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
|||||||||||||||||| |||||||||| || ||||||||||| |
|
|
T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||| |||| |||||||||||||| | | |||||||||||| |
|
|
T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 35212067 - 35212099
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
35212067 |
aggctaaaatatgtttttggtccctgcaaatat |
35212099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Complemental strand, 36687264 - 36687232
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||| ||||||||||||||||||| |
|
|
T |
36687264 |
aggctaaaatatgattttggtccctgcaaatat |
36687232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 38186762 - 38186710
Alignment:
Q |
341 |
aggctaaaatatggtttt-ggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| |||| ||||||||||||||| || |||||||||||||| |
|
|
T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt |
38186710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 355 - 399
Target Start/End: Complemental strand, 41054163 - 41054119
Alignment:
Q |
355 |
ttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgta |
41054119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 345 - 373
Target Start/End: Complemental strand, 44841711 - 44841683
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
44841711 |
taaaatatggttttggtccctgcaaatat |
44841683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 7e-19; HSPs: 162)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 24443747 - 24443687
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
24443747 |
ataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
24443687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 5614532 - 5614473
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
5614532 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgta |
5614473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 19685381 - 19685323
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
19685323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 28871995 - 28871937
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgta |
28871937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 38170513 - 38170571
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgta |
38170571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 42596452 - 42596510
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||| |
|
|
T |
42596452 |
aggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgta |
42596510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 1105150 - 1105093
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
1105150 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 19565833 - 19565776
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
19565833 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 1381612 - 1381556
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 5917461 - 5917405
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 23381947 - 23382007
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
23381947 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgta |
23382007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 30800491 - 30800551
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
30800491 |
ataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30800551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 35928063 - 35928119
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 40764414 - 40764470
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 1104856 - 1104915
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
1104856 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgta |
1104915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 1381241 - 1381304
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
1381241 |
ataaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
1381304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 5950174 - 5950233
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
5950174 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
5950233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 10830527 - 10830586
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| || ||||||| ||| ||||||||||||||||||||| |
|
|
T |
10830527 |
taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgta |
10830586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 20660947 - 20660998
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20660998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 29692742 - 29692801
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
29692742 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
29692801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 30800852 - 30800793
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
30800793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 37271357 - 37271416
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||| |
|
|
T |
37271357 |
taggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgta |
37271416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 2217493 - 2217551
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
2217551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 5917123 - 5917181
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
5917123 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 7075571 - 7075629
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
7075629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 18286742 - 18286684
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| |||||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagttactgta |
18286684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 339 - 397
Target Start/End: Original strand, 19685014 - 19685072
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
19685014 |
ataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 338 - 392
Target Start/End: Original strand, 20690729 - 20690783
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
20690729 |
aataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
20690783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 23382297 - 23382247
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
23382247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 28863509 - 28863567
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28863567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 391
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 36578084 - 36578026
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
36578026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 45138 - 45195
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
45195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 331 - 392
Target Start/End: Complemental strand, 2217865 - 2217804
Alignment:
Q |
331 |
aatttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||| || |||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
2217865 |
aatttaaaagaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2217804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 343 - 392
Target Start/End: Complemental strand, 2636992 - 2636943
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
2636943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 28863838 - 28863781
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
28863781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 29366949 - 29366892
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
29366892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 29875727 - 29875670
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29875727 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 30888160 - 30888217
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 35928458 - 35928401
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
35928401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 40029497 - 40029440
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
40029440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 40038858 - 40038801
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| ||||||||||||||||||| |||||||||||||||| | |||||| |
|
|
T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgta |
40038801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 11799128 - 11799184
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | |||||||||||||||| |||| |
|
|
T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 338 - 402
Target Start/End: Original strand, 12144903 - 12144967
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtattt |
402 |
Q |
|
|
||||||||||||||||||||| ||||||| |||||| ||| ||||||||||||| ||||||||| |
|
|
T |
12144903 |
aataggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgtattt |
12144967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 18046350 - 18046298
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
18046350 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18046298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 18633598 - 18633654
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 19565466 - 19565522
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 20986090 - 20986034
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 24443379 - 24443435
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 398
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 29151852 - 29151796
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| || ||||||||||| ||| ||||||||||||||||||| |
|
|
T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 29172887 - 29172831
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 344 - 392
Target Start/End: Original strand, 31037397 - 31037445
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagt |
31037445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 35167166 - 35167110
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 344 - 396
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct |
35609583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 35876687 - 35876743
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| | | |||||||||||||| |||| |
|
|
T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 36577719 - 36577779
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
36577719 |
ataggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
36577779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 40764781 - 40764725
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Complemental strand, 6912855 - 6912800
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
6912800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 10743723 - 10743774
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10743774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 16038376 - 16038427
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16038427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 18258528 - 18258477
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
18258477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 25779164 - 25779105
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| | | |||||||||||||||||||| |
|
|
T |
25779164 |
taggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgta |
25779105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 28213372 - 28213423
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
28213423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 35877054 - 35877003
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
35877054 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
35877003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 4736543 - 4736485
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgta |
4736485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 11799459 - 11799401
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgta |
11799401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 26133414 - 26133356
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgta |
26133356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 28108159 - 28108105
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgta |
28108105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 343 - 397
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 33336031 - 33335969
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
T |
33336031 |
taattggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgta |
33335969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 38786158 - 38786216
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgta |
38786216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 40167785 - 40167843
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| ||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
40167843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 1286682 - 1286739
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||| ||||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgta |
1286739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 20661311 - 20661254
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| ||||||||| | | |||||||||||||| |||||| |
|
|
T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgta |
20661254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 26133183 - 26133240
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||| ||||||| ||| |||||||||||||| |||||| |
|
|
T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgta |
26133240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 32888691 - 32888744
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgta |
32888744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 35609303 - 35609360
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| ||||||||| | | |||||||||||||| |||||| |
|
|
T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgta |
35609360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 336 - 397
Target Start/End: Original strand, 39379233 - 39379294
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||| ||||||||| |||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
39379233 |
ataataggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 6118499 - 6118451
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 10408927 - 10408983
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 10409328 - 10409276
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |
|
|
T |
10409328 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
10409276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 15635708 - 15635652
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||| |||| |
|
|
T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 18258161 - 18258217
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 18633961 - 18633913
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 338 - 398
Target Start/End: Original strand, 24781985 - 24782045
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||||||| ||| |||||||||| || |||||||||||||| ||||| |
|
|
T |
24781985 |
aataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 34125305 - 34125357
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
34125305 |
taggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
34125357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 37271707 - 37271651
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||| ||||||| |||| |
|
|
T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 39379612 - 39379560
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| | | |||||||||||||| |
|
|
T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
39379560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 338 - 390
Target Start/End: Original strand, 40038490 - 40038542
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||| ||| |||||| ||||| |
|
|
T |
40038490 |
aataggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 293827 - 293878
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||| ||||||| |
|
|
T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
293878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 4203772 - 4203713
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
4203772 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
4203713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 5904006 - 5904065
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||| ||||||||| ||| |||||| ||||||| |||||| |
|
|
T |
5904006 |
taggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgta |
5904065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 336 - 399
Target Start/End: Complemental strand, 9179926 - 9179863
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| |||||||||||||||||| |||| ||||||||| ||| |||||||||||| | |||||| |
|
|
T |
9179926 |
ataaaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgta |
9179863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 10744056 - 10743997
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgta |
10743997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 13990896 - 13990845
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||| |||||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
13990845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | |||||||||||||| |||| |
|
|
T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 28871635 - 28871694
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||| ||||||||| ||||||||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
28871635 |
taggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgta |
28871694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 1287042 - 1286988
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||| |||||| || |||||||||||||||||||| |
|
|
T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgta |
1286988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 2636669 - 2636719
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt |
2636719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 18046037 - 18046095
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |||||| |
|
|
T |
18046037 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgta |
18046095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 21124912 - 21124970
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
21124970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 31037743 - 31037693
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||| |
|
|
T |
31037743 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 34125633 - 34125575
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| ||| ||||||||||||| |||||| |
|
|
T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgta |
34125575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 40168013 - 40167951
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||| ||||| |||| ||||||||| || |||||||||||||| |||||| |
|
|
T |
40168013 |
taataggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgta |
40167951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 42553642 - 42553692
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42553692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 42596814 - 42596760
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||||||| || ||||| |||||||| |||||| |
|
|
T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgta |
42596760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 3850601 - 3850544
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||| |||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 5104001 - 5103944
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||| || |||||||||||||| ||||| |
|
|
T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgta |
5103944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 10830899 - 10830846
Alignment:
Q |
340 |
taggctaaaatatggtttt-ggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||| ||||||||||||||| |||| ||||||||||||| |
|
|
T |
10830899 |
taggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagt |
10830846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 21050913 - 21050856
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| | | |||||| ||||||| |||||| |
|
|
T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgta |
21050856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 341 - 402
Target Start/End: Original strand, 26071290 - 26071351
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgtattt |
402 |
Q |
|
|
|||||||||||| |||| ||||||||||||||| || ||||||||||||| ||||||||| |
|
|
T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgtattt |
26071351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 373
Target Start/End: Original strand, 32108806 - 32108839
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
32108806 |
taggctaaaatatggttttggtccctgcaaatat |
32108839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 36973353 - 36973410
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||| || ||||||| || |||||||||||||||| |||| |
|
|
T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttcatgta |
36973410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 36973710 - 36973653
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||||||||| |||||| || |||||| ||||||| |||||| |
|
|
T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgta |
36973653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 38554749 - 38554799
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
T |
38554749 |
taggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagt |
38554799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 38962806 - 38962863
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| ||||||| |||||| || |||||||||||||||| |||| |
|
|
T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcttgta |
38962863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 14318043 - 14318095
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||| ||||||||| || |||||||||||||| |
|
|
T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
14318095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 345 - 397
Target Start/End: Original strand, 15635379 - 15635431
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| |||| ||||||||| ||||||||||||||||| |||| |
|
|
T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 16038738 - 16038690
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
16038690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 17070534 - 17070566
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
17070534 |
aggctaaaatatggttttggtccctgcaaatat |
17070566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 29875399 - 29875455
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||| ||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 38496783 - 38496727
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | |||||||||||||| |||| |
|
|
T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 38555085 - 38555034
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
T |
38555085 |
taggctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagt |
38555034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 3850299 - 3850346
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||| |||||||||||| | ||| ||||||||||| |
|
|
T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 5614165 - 5614216
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |
|
|
T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
5614216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 9532532 - 9532485
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| |||| ||||||||| ||| |||||||||||||| |
|
|
T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
9532485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 373
Target Start/End: Original strand, 9588358 - 9588389
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
9588358 |
ggctaaaatatggttttggtccctgcaaatat |
9588389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 27916761 - 27916714
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagt |
27916714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||| ||||||| |||| |
|
|
T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 29693091 - 29693040
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| |||| |||||||||||||| | | |||||||||||||| |
|
|
T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
29693040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 42207240 - 42207299
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||| || |||||| || |||||||||||||| |||||| |
|
|
T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgta |
42207299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 2032940 - 2032890
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||| ||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagt |
2032890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 9179592 - 9179650
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| | |||||||||||||| |||||| |
|
|
T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgta |
9179650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 15916286 - 15916336
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||| ||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagt |
15916336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||| |||||||||||||| || ||||||||||| ||||||||||||||| |
|
|
T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 20683746 - 20683804
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||| |||||||||| | | |||||| ||||||| |||||| |
|
|
T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgta |
20683804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 26071613 - 26071559
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||| ||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgta |
26071559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Original strand, 31540494 - 31540528
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
31540494 |
taggctaaaatatgtttttggtccctgcaaatata |
31540528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 389
Target Start/End: Original strand, 32888760 - 32888794
Alignment:
Q |
355 |
ttttggtccctgcaaatataccttgttttggtttt |
389 |
Q |
|
|
||||||||||||||||||| ||||||||||||||| |
|
|
T |
32888760 |
ttttggtccctgcaaatatgccttgttttggtttt |
32888794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 336 - 374
Target Start/End: Complemental strand, 34911893 - 34911855
Alignment:
Q |
336 |
ataataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||| ||||||||||||| |||||||||||||||||||| |
|
|
T |
34911893 |
ataaaaggctaaaatatgattttggtccctgcaaatata |
34911855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 344 - 390
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 40029140 - 40029198
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||| |||||| || |||||||||||| | |||||| |
|
|
T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgta |
40029198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 350 - 392
Target Start/End: Complemental strand, 42554000 - 42553958
Alignment:
Q |
350 |
tatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| ||||||||| |||||||||||||||| |
|
|
T |
42554000 |
tatggttttggtccccgcaaatatattttgttttggttttagt |
42553958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 342 - 396
Target Start/End: Original strand, 42994068 - 42994122
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||| ||||| ||||| |
|
|
T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct |
42994122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 345 - 390
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||||||||||||||||||| | |||||||||||| |
|
|
T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 3936577 - 3936610
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
3936577 |
aggctaaaatatgtttttggtccctgcaaatata |
3936610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 7085476 - 7085520
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttgg |
385 |
Q |
|
|
||||||||||||||||||| ||||||| |||||| ||||||||||| |
|
|
T |
7085476 |
taggctaaaatatggtttt-gtccctgtaaatatgccttgttttgg |
7085520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 344 - 373
Target Start/End: Complemental strand, 12145181 - 12145152
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
12145181 |
ctaaaatatggttttggtccctgcaaatat |
12145152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 27571189 - 27571156
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
27571189 |
aggctaaaatatgattttggtccctgcaaatata |
27571156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 35166160 - 35166103
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||| ||||||||||| ||||||||||| || || |||||||||||||| |||| |
|
|
T |
35166160 |
taggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 373
Target Start/End: Original strand, 36278079 - 36278112
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |
|
|
T |
36278079 |
taggctaaaatatggttttgatccctgcaaatat |
36278112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 392
Target Start/End: Original strand, 16616370 - 16616418
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| |||| |||||||| |
|
|
T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt |
16616418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 391
Target Start/End: Complemental strand, 17070866 - 17070814
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttag |
391 |
Q |
|
|
|||||||||||||||||||| |||||| ||||||| || ||||| ||||||| |
|
|
T |
17070866 |
ataggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 20416359 - 20416391
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatat |
20416391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 392
Target Start/End: Complemental strand, 20691094 - 20691046
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||| ||||||| ||||||||||| || |||||||||||||| |
|
|
T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagt |
20691046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 343 - 399
Target Start/End: Original strand, 29855614 - 29855670
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||| ||||||||| || |||||| ||| ||||||||||||| |||||| |
|
|
T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgta |
29855670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 339 - 387
Target Start/End: Original strand, 31602140 - 31602188
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggtt |
387 |
Q |
|
|
|||||||||||||| |||||| ||||||||||||| | | ||||||||| |
|
|
T |
31602140 |
ataggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 338 - 399
Target Start/End: Original strand, 3748 - 3809
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||| | |||||| |
|
|
T |
3748 |
aataggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgta |
3809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 4082 - 4029
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||| ||||||||||||||||||||| || ||||| |||||||| |
|
|
T |
4082 |
ataggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagt |
4029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 46; Significance: 5e-17; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 340 - 397
Target Start/End: Complemental strand, 75766 - 75709
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
75766 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 340 - 399
Target Start/End: Original strand, 75357 - 75416
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
75357 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgta |
75416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 10518 - 10458
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
T |
10518 |
ataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgta |
10458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 10168 - 10218
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
10218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 27366 - 27307
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
27366 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
27307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 5398 - 5449
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
5449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 5709 - 5653
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 2777 - 2835
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
2835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 340 - 398
Target Start/End: Original strand, 14695 - 14753
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 15013 - 14955
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || ||||||||||||| |||||| |
|
|
T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgta |
14955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 366274 - 366216
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
366216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 365979 - 366036
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| ||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgta |
366036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 9028 - 8971
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
8971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 344 - 399
Target Start/End: Original strand, 8734 - 8789
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
8789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 16724 - 16781
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgta |
16781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 148282 - 148225
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
148225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Original strand, 119593 - 119625
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
119593 |
ggctaaaatatgcttttggtccctgcaaatata |
119625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 121044 - 121012
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
121044 |
ggctaaaatatgcttttggtccctgcaaatata |
121012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 333 - 397
Target Start/End: Original strand, 1302 - 1366
Alignment:
Q |
333 |
tttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||| |||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
1302 |
tttataaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 1645 - 1589
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| ||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 47924 - 47980
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 345 - 392
Target Start/End: Complemental strand, 48228 - 48181
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
48181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 399
Target Start/End: Original strand, 222817 - 222870
Alignment:
Q |
346 |
aaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||| |||| |||||| ||||||| |||||||||||||||||||||||| |
|
|
T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgta |
222870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 340 - 373
Target Start/End: Complemental strand, 223174 - 223141
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
223174 |
taggctaaaatatggttttggtccctgcaaatat |
223141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 5208 - 5266
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
5266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 5228 - 5286
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgta |
5286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 345 - 399
Target Start/End: Complemental strand, 5067 - 5013
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| ||||||||||| || ||||||||||||||| ||||| |
|
|
T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgta |
5013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 3919 - 3861
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||||||||||||| | | |||||||||||||| |||||| |
|
|
T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgta |
3861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 3532 - 3582
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
3582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 341 - 399
Target Start/End: Original strand, 54814 - 54872
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||| |||||||||||||| |||||| |
|
|
T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgta |
54872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 397
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
Q |
345 |
taaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||||||||||| |||| |
|
|
T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 337 - 374
Target Start/End: Complemental strand, 30971 - 30934
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
30971 |
taataggctaaaatatggttttggtccctgcaaatata |
30934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 372
Target Start/End: Original strand, 29727 - 29759
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaata |
372 |
Q |
|
|
|||||||||||||| |||||||||||||||||| |
|
|
T |
29727 |
taggctaaaatatgcttttggtccctgcaaata |
29759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 12182 - 12239
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| ||||| |||||||| |||||| |
|
|
T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgta |
12239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 12536 - 12486
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
12486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Original strand, 8546 - 8602
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
||||||||||||| |||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 341 - 397
Target Start/End: Complemental strand, 290 - 234
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||| |
|
|
T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 4039 - 4091
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
4091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 19221 - 19273
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 4289 - 4238
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
4238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 19471 - 19420
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
19420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 338 - 398
Target Start/End: Original strand, 24368 - 24428
Alignment:
Q |
338 |
aataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgt |
398 |
Q |
|
|
||||||||||||||||||||| ||| |||||||||| || |||||||||||||| ||||| |
|
|
T |
24368 |
aataggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 339 - 399
Target Start/End: Original strand, 94054 - 94114
Alignment:
Q |
339 |
ataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| |||||| ||||||| ||| |||||||||||| | |||||| |
|
|
T |
94054 |
ataggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgta |
94114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 343 - 390
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
Q |
343 |
gctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
|||||||||||||||| |||||| ||||||| ||| |||||||||||| |
|
|
T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 345958 - 345924
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
345958 |
taggctaaaatatgtttttggtccctgcaaatata |
345924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 376430 - 376396
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||||| |||||||||||||||||||| |
|
|
T |
376430 |
taggctaaaatatgcttttggtccctgcaaatata |
376396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 3293 - 3234
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| ||||||||||||| || |||||||||||||| |||||| |
|
|
T |
3293 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgta |
3234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 22056 - 22005
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||||| ||||| | ||| |||||||||||||| |
|
|
T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagt |
22005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 21695 - 21727
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||||||| ||||||||||||| |
|
|
T |
21695 |
aggctaaaatatggttttgatccctgcaaatat |
21727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 397
Target Start/End: Original strand, 34931 - 34986
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||||||| || |||||||||||||| ||| |||||||||||||| |||| |
|
|
T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 18045 - 17986
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||||| |||||||| ||||| ||| ||||||| |||||| |||||| |
|
|
T |
18045 |
taggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgta |
17986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 337 - 392
Target Start/End: Original strand, 2496 - 2551
Alignment:
Q |
337 |
taataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||| | | |||||| ||||||| |
|
|
T |
2496 |
taataggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagt |
2551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 373
Target Start/End: Complemental strand, 2883 - 2852
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
2883 |
ggctaaaatatggttttggtccctgcaaatat |
2852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 341 - 399
Target Start/End: Complemental strand, 7265 - 7207
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||| |||||||| |||||||||| ||||||||||||||| || ||||| |
|
|
T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttaatttctgta |
7207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 4312 - 4266
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttt |
388 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 349 - 397
Target Start/End: Original strand, 4016 - 4064
Alignment:
Q |
349 |
atatggttttggtccctgcaaatataccttgttttggttttagttcctg |
397 |
Q |
|
|
|||||||||| |||||| ||||||| ||| |||||||||||||| |||| |
|
|
T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 12525 - 12575
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
12575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 332 - 394
Target Start/End: Original strand, 189319 - 189381
Alignment:
Q |
332 |
atttataataggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttc |
394 |
Q |
|
|
|||||| |||||||||||||| |||||| | |||| |||||| ||| |||||||||||||||| |
|
|
T |
189319 |
atttattataggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagttc |
189381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 373
Target Start/End: Original strand, 61631 - 61663
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatat |
373 |
Q |
|
|
||||||||||||||| ||||||||||||||||| |
|
|
T |
61631 |
aggctaaaatatggtattggtccctgcaaatat |
61663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 17966 - 17909
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
||||||||||||||||| |||||||||||||| ||| |||| ||||| ||| |||||| |
|
|
T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgta |
17909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 344 - 396
Target Start/End: Original strand, 17126 - 17178
Alignment:
Q |
344 |
ctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcct |
396 |
Q |
|
|
|||||||||||||||||||||| ||||||| | |||||||||||||||||| |
|
|
T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcct |
17178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 340 - 399
Target Start/End: Complemental strand, 35086 - 35027
Alignment:
Q |
340 |
taggctaaaatatggttttggtccctgcaaatataccttgttttggttttagttcctgta |
399 |
Q |
|
|
|||||||||||||||||||| ||| | ||||||| || |||||||||||||| |||||| |
|
|
T |
35086 |
taggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgta |
35027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 8329 - 8380
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |
|
|
T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 8643 - 8592
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatataccttgttttggttttagt |
392 |
Q |
|
|
|||||||||||||||||| |||||||||||||| || |||||| ||||||| |
|
|
T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Complemental strand, 11582 - 11549
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
11582 |
aggctaaaatatgtttttggtccctgcaaatata |
11549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Original strand, 10315 - 10347
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
10315 |
ggctaaaatatgcttttggtccctgcaaatata |
10347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 341 - 374
Target Start/End: Original strand, 202578 - 202611
Alignment:
Q |
341 |
aggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
||||||||||||| |||||||||||||||||||| |
|
|
T |
202578 |
aggctaaaatatgcttttggtccctgcaaatata |
202611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 374
Target Start/End: Complemental strand, 490 - 458
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatata |
374 |
Q |
|
|
|||||||||||| |||||||||||||||||||| |
|
|
T |
490 |
ggctaaaatatgattttggtccctgcaaatata |
458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
Q |
342 |
ggctaaaatatggttttggtccctgcaaatataccttgttttggtttta |
390 |
Q |
|
|
||||||||||||| |||||||||||||||||| | | ||||||||||| |
|
|
T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University