View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_213 (Length: 269)
Name: NF0412_low_213
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_213 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 34144894 - 34145078
Alignment:
Q |
1 |
aaagtaaattattgaggaagatgttgaagtaccaaaacttggaaatctcgttgataaagcatgaggttgtagaaagagttgggcgaggtagattttgttc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34144894 |
aaagtaaattattgaggaagatgttgaagtaccaaaacttggaaatctcgttgataaagcatgaggttgtagaaagagttgggcgaggtagattttgttc |
34144993 |
T |
 |
Q |
101 |
gttgaaagtgatcaaagaatctacagtggtgagtacaagaactacacacttgtacttgttgattgcgaaacattgtactgttctt |
185 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||| |
|
|
T |
34144994 |
gttgaaagtgatcaaagaatctacagtggtgagtacaagaactacacacttttacttgttgattgcgaaccattgcactgttctt |
34145078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University