View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_214 (Length: 268)
Name: NF0412_low_214
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_214 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 43 - 225
Target Start/End: Original strand, 25320976 - 25321159
Alignment:
Q |
43 |
tatttcaccctagaccaatcatccaacgatgaattactagatgttttttggcctgaaaaacccaaagacataccatacatatgagaaataggaaggttga |
142 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
T |
25320976 |
tatttcaccctagaccaatcatccaacgatgaattactaaatgttttttggcctgaaaatcc-aaagacataccatacaaatgagaaataggaaggttga |
25321074 |
T |
 |
Q |
143 |
attgaataattatcataaatttgaaaa--atatggtaccgttttcatgtatgtaaattggaaaatttccataattgttcttcatc |
225 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
25321075 |
attgaataattatcataaatttgaaaaatatatggtaccgttttcatgtatgtaaattggaaactttccataattgttcttcatc |
25321159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 223
Target Start/End: Original strand, 25326881 - 25326928
Alignment:
Q |
176 |
taccgttttcatgtatgtaaattggaaaatttccataattgttcttca |
223 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
25326881 |
taccattttcatgtatgtaaattggaaaatttccataatcattcttca |
25326928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University