View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_215 (Length: 268)
Name: NF0412_low_215
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_215 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 30 - 234
Target Start/End: Original strand, 20453758 - 20453961
Alignment:
Q |
30 |
aaaacataatttggaacacctctactactagttcaaaatctcaacatatgagaatttgatattaaggggatattctttaccatatgtatgtcacttatgt |
129 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||| |
|
|
T |
20453758 |
aaaacataatttggaacacctctactactccttcaaaatctcaacatatgagaatttgatattaaggg-atattctttaccatatgtctgtaacttatgt |
20453856 |
T |
 |
Q |
130 |
atcaagcaaactgagtcaagtaaacacctaattttttattgtcggtatcctactagaatatggtcttgtttgataaataccatcaatatctcaatgtcgt |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
T |
20453857 |
atcaagcaaactgagtcaagtaaacacctaattttttattgtcggtatcctactagaatatggtcttgtttgataaataccatcaatatctcagtgttgt |
20453956 |
T |
 |
Q |
230 |
gtcag |
234 |
Q |
|
|
||||| |
|
|
T |
20453957 |
gtcag |
20453961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University