View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_224 (Length: 266)

Name: NF0412_low_224
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_224
NF0412_low_224
[»] chr4 (2 HSPs)
chr4 (31-223)||(50569882-50570074)
chr4 (35-114)||(21156121-21156199)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 31 - 223
Target Start/End: Complemental strand, 50570074 - 50569882
Alignment:
31 atacttttaaatagactagataaaacaagtattgatagtgttccaattaaaatattataacttgccacgaacccaaataatgtagtgagaatgtagcccc 130  Q
    ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
50570074 atactttaaaatagactagataaaacaagtattgatagtgttgcaattaaaatattataacttgccacgaacacaaataatgtagtgagaatgtagcccc 50569975  T
131 aattgacacagtagaatttacttgaagtgcaagatacaaatgaaattgagagaaaataggtggtgatgcacaatttgttgtaatgtgtattct 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50569974 aattgacacagtagaatttacttgaagtgcaagatacaaatgaaattgagagaaaataggtggtgatgcacaatttgttgtaatgtgtattct 50569882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 35 - 114
Target Start/End: Original strand, 21156121 - 21156199
Alignment:
35 ttttaaatagactagataaaacaagtattgatagtgttccaattaaaatattataacttgccacgaacccaaataatgta 114  Q
    |||||| |||||||||||||| || ||||||||   | ||||| ||||||||| ||||| ||||||||||||||| ||||    
21156121 ttttaactagactagataaaaaaa-tattgataacataccaataaaaatattagaacttaccacgaacccaaatactgta 21156199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1395 times since January 2019
Visitors: 3083