View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_225 (Length: 266)
Name: NF0412_low_225
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_225 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 51 - 227
Target Start/End: Original strand, 37500386 - 37500563
Alignment:
| Q |
51 |
gtttagtggttttggataaagattttagagtgtgtttctcatgttcaattttttctaatgtcaatttaagtaaattagtttaacttttttnnnnnnncaa |
150 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37500386 |
gtttagtggttttggataaagagtttagagtgtgcttctcatgttcaattttttctaatgtcaatttaagtaaattagtttaactttaaaaaaaaaacaa |
37500485 |
T |
 |
| Q |
151 |
tgatcaactataataaaag-nnnnnnnnntcaatatataacaaattaaaaatctcatatatacaagtacactttttag |
227 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
37500486 |
tgatcaactataacaaaagaaaaaaaaaatcaatatataacaaattaaaaatctcatttatacaagtacacttcttag |
37500563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University