View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_226 (Length: 266)

Name: NF0412_low_226
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_226
NF0412_low_226
[»] chr4 (1 HSPs)
chr4 (10-199)||(53112161-53112350)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 199
Target Start/End: Complemental strand, 53112350 - 53112161
Alignment:
10 agtgtagcttgtcaccccctgtatatgatctggattcagtttctgattgaattgttatttcgagtggctgatgcaatatatcagaaatttattgatcaag 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53112350 agtgtagcttgtcaccccctgtatatgatctggattcagtttctgattgaattgttatttcgagtggctgatgcaatatatcagaaatttattgatcaag 53112251  T
110 cggcttggacaagaaaattaaagttgtcacccctagttgattgaattgattgaattactattgttcattcaatggttattattttatgat 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53112250 cggcttggacaagaaaattaaagttgtcacccctagttgattgaattgattgaattactattgttcattcaatggttattattttatgat 53112161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University