View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_227 (Length: 266)
Name: NF0412_low_227
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_227 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 199
Target Start/End: Complemental strand, 53112351 - 53112161
Alignment:
| Q |
9 |
cagtgtagcttgtcaccccctgtatatgatctggattcagtttctgattgaattgttatttcgagtggctgatgcaatatatcagaaatttattgatcaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53112351 |
cagtgtagcttgtcaccccctgtatatgatctggattcagtttctgattgaattgttatttcgagtggctgatgcaatatatcagaaatttattgatcaa |
53112252 |
T |
|
| Q |
109 |
gcggcttggacaagaaaattaaagttgtcacccctagttgattgaattgattgaattactattgttcattcaatggttattattttatgat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53112251 |
gcggcttggacaagaaaattaaagttgtcacccctagttgattgaattgattgaattactattgttcattcaatggttattattttatgat |
53112161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1010 times since January 2019
Visitors: 3074