View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_229 (Length: 265)
Name: NF0412_low_229
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_229 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 102 - 222
Target Start/End: Original strand, 44694335 - 44694457
Alignment:
Q |
102 |
ctatatcctagttttcgaaacaagatgcgtcaatctttgctatgtaattattaatgt--tgcaaaatgaaataactggtatatttttgttttgacaagaa |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44694335 |
ctatatcctagttttcgaaacaagatgcgtcaatctttgctatgtaattattaattaactgcaaaatgaaataactggtatatttttgttttgacaagaa |
44694434 |
T |
 |
Q |
200 |
atatgctaaaatgatgaaatttt |
222 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
44694435 |
atatgctaaaatgatgaaatttt |
44694457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University