View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_229 (Length: 265)

Name: NF0412_low_229
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_229
NF0412_low_229
[»] chr3 (1 HSPs)
chr3 (102-222)||(44694335-44694457)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 102 - 222
Target Start/End: Original strand, 44694335 - 44694457
Alignment:
102 ctatatcctagttttcgaaacaagatgcgtcaatctttgctatgtaattattaatgt--tgcaaaatgaaataactggtatatttttgttttgacaagaa 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||    
44694335 ctatatcctagttttcgaaacaagatgcgtcaatctttgctatgtaattattaattaactgcaaaatgaaataactggtatatttttgttttgacaagaa 44694434  T
200 atatgctaaaatgatgaaatttt 222  Q
    |||||||||||||||||||||||    
44694435 atatgctaaaatgatgaaatttt 44694457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University