View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_233 (Length: 262)
Name: NF0412_low_233
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_233 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 24 - 222
Target Start/End: Complemental strand, 34516412 - 34516218
Alignment:
Q |
24 |
atgaactcacagaagcacaaatatataataaagnnnnnnncaatggaattaaaattgaaatattcatgggaatattattatattcacaaaa-tcatatgg |
122 |
Q |
|
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
T |
34516412 |
atgaactcgcagaagcacaaatatataataaagaaaaaaacaatggaattaaaattgaaacattcatgggaatattat---attcacaaaaatcatatgg |
34516316 |
T |
 |
Q |
123 |
nnnnnnnnnnttaatcattgcatttgaaacaagagagaaagacaacaagaacaactattacctggaaaatcacagtagacattgattctttcctagaaaa |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
34516315 |
aaaaaaaa--ttaatcattgcatttgaaacaagagagaaagacaacaagaacaactattacctggaaaatcacagtagacactgattctttcctagaaaa |
34516218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 599 times since January 2019
Visitors: 3061