View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_235 (Length: 261)
Name: NF0412_low_235
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_235 |
 |  |
|
[»] scaffold0101 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0101 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: scaffold0101
Description:
Target: scaffold0101; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 37 - 159
Target Start/End: Complemental strand, 13003 - 12881
Alignment:
Q |
37 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatgcaacttccctcagnnnnnnngaattttgtgtttgggtgttacagcgga |
136 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
13003 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatgcaacttccctcagttcttttgaattttgtgtttgggtgttacagcgga |
12904 |
T |
 |
Q |
137 |
gacagactatgaatatttggtgt |
159 |
Q |
|
|
|||||||||||||||||| |||| |
|
|
T |
12903 |
gacagactatgaatatttagtgt |
12881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 7e-21; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 37 - 88
Target Start/End: Complemental strand, 17322257 - 17322206
Alignment:
Q |
37 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatg |
88 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17322257 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatg |
17322206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 37 - 88
Target Start/End: Complemental strand, 17328035 - 17327984
Alignment:
Q |
37 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatg |
88 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17328035 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatg |
17327984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 88
Target Start/End: Complemental strand, 17305425 - 17305374
Alignment:
Q |
37 |
tcatctggtgttaacagggttagtgttacatgggtttggtgtaccacaaatg |
88 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
17305425 |
tcatctggtgttaacggggttagtgttacatgggtttggtgtaccacaaatg |
17305374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 167 - 238
Target Start/End: Complemental strand, 17342217 - 17342146
Alignment:
Q |
167 |
acgtcgctatcgtcatggataattggaagataataaactgtttttcacacgtcttcgtctttgtttgcccta |
238 |
Q |
|
|
||||||||||||||| | |||| ||| ||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
17342217 |
acgtcgctatcgtcacgaataaccggacgataataaactgtttttcacatgtcttcgtctttgtctgcccta |
17342146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 17318662 - 17318599
Alignment:
Q |
167 |
acgtcgctatcgtcatggataattggaagataataaactgtttttcacacgtcttcgtctttgt |
230 |
Q |
|
|
||||||||||||||| |||| ||| ||||||||| ||||||||||| |||||||||||||| |
|
|
T |
17318662 |
acgtcgctatcgtcacaaataaccggaggataataaattgtttttcacatgtcttcgtctttgt |
17318599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 195 - 228
Target Start/End: Original strand, 25658863 - 25658896
Alignment:
Q |
195 |
gataataaactgtttttcacacgtcttcgtcttt |
228 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
25658863 |
gataataaactgtttttcacacgtcttcatcttt |
25658896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1097 times since January 2019
Visitors: 3075