View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0412_low_240 (Length: 259)

Name: NF0412_low_240
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0412_low_240
NF0412_low_240
[»] chr8 (1 HSPs)
chr8 (104-225)||(3702109-3702230)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 104 - 225
Target Start/End: Complemental strand, 3702230 - 3702109
Alignment:
104 aatcaagggtttgaaacgaataactttgatctacttcttgggtagggaaactatgtataaaaatataatatttctcttcttcttgagaagcttccatgtt 203  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||    
3702230 aatccagggtttgaaacgaataactttgatctacttcttgggtagggaaactatgtataaaaatagaatacttctcttcttcttgagaagcttccatgtt 3702131  T
204 ttttggattggttgtacttcat 225  Q
    ||||||||||||||||||||||    
3702130 ttttggattggttgtacttcat 3702109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1271 times since January 2019
Visitors: 3079