View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_242 (Length: 259)
Name: NF0412_low_242
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_242 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 95 - 242
Target Start/End: Complemental strand, 49916242 - 49916099
Alignment:
| Q |
95 |
gtgagatgaatggtaaatagtaagtatgctactaatcctactatatactctctccatacaaagtttaagcacaattctttctttattgtaaaagtatatt |
194 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49916242 |
gtgaaatgaatggtaaatagtaagtatgctactaatcctactatatactctctacatacaaagtttaagcacaatt----ctttattgtaaaagtatatt |
49916147 |
T |
 |
| Q |
195 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccata |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49916146 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccata |
49916099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University