View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_246 (Length: 258)
Name: NF0412_low_246
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0412_low_246 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 37 - 237
Target Start/End: Complemental strand, 35350959 - 35350759
Alignment:
| Q |
37 |
gttgatcgcctccaaatttgtggttaataaaaggattaactatgattttagtccctccaattatagagnnnnnnnnnnnnnnnnnnnagtccctataact |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
35350959 |
gttgatcgcctccaaatttgtggttaataaaaggattaactatgattttagtccctccaattatagagttttttggttttactttttagtccatataact |
35350860 |
T |
|
| Q |
137 |
ttttctgtttagattcacgcctgcaagttaaaaaattgttacttttagtccttgatggcatgcatagctcaataaaatcatgccacattgcccaatatgt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350859 |
ttttctgtttagattcacgcctgcaagttaaaaaattgttacttttagtccttgacagcatacatagctcaataaaatcatgccacattgcccaatatgt |
35350760 |
T |
|
| Q |
237 |
t |
237 |
Q |
| |
|
| |
|
|
| T |
35350759 |
t |
35350759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 926 times since January 2019
Visitors: 3072