View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0412_low_252 (Length: 254)
Name: NF0412_low_252
Description: NF0412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0412_low_252 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 28 - 254
Target Start/End: Complemental strand, 22383048 - 22382822
Alignment:
Q |
28 |
caaccataacttcgatatcagtacccattagagctgtcaaaatggtatcatcagcatcaaaaagcttcaattttcgaaacccgttgtccttaagcatctt |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
22383048 |
caaccataacttcgatatcagtacccattagagctgtcaaaatggtatcatcagcatcaaaaagtttcaattttcgaaacccgttgtccttaagcatctt |
22382949 |
T |
 |
Q |
128 |
cacaactttcttaggtggaagttggtgggttgtcattgttccccagtttacaccaacccaagcagaggaagatgagattatggttaggaagatgatgagg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22382948 |
cacaactttcttaggtggaagttggtgggttgtcattgttccccagtttacaccaacccaagcagaggaagatgagattatggttaggaagatgatgagg |
22382849 |
T |
 |
Q |
228 |
aatgttgctaggtatatgcaatatgat |
254 |
Q |
|
|
|||||||||||||||||||||| |||| |
|
|
T |
22382848 |
aatgttgctaggtatatgcaatttgat |
22382822 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University